ID: 904744252

View in Genome Browser
Species Human (GRCh38)
Location 1:32701721-32701743
Sequence CCCTGACCTCGGGCTTCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904744246_904744252 -7 Left 904744246 1:32701705-32701727 CCAGCTTAGTTGGGGCCCCTGAC 0: 1
1: 0
2: 0
3: 7
4: 77
Right 904744252 1:32701721-32701743 CCCTGACCTCGGGCTTCCTTGGG 0: 1
1: 0
2: 1
3: 29
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904744252 Original CRISPR CCCTGACCTCGGGCTTCCTT GGG Intronic
902917111 1:19645515-19645537 CCCTGACCTCTGTTTTCCTGGGG - Intronic
904744252 1:32701721-32701743 CCCTGACCTCGGGCTTCCTTGGG + Intronic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
907860248 1:58345849-58345871 CTCTGACCTTAGGCTTCCTTGGG + Intronic
908675578 1:66599805-66599827 CCCTCTCCTCGGGTTTCCTGTGG + Intronic
912374232 1:109197506-109197528 CACTGACCTCCGGATTCCTGAGG + Exonic
912658326 1:111507398-111507420 CCCTGGCCTGGGGCCTACTTGGG + Intronic
913047755 1:115088908-115088930 CCCTGCCCTGGGGCTGCCTGGGG - Intronic
918317964 1:183339016-183339038 CCCTGCCCAAGGGCTCCCTTAGG + Intronic
918487719 1:185046198-185046220 CCTCGACCTCGGGGTTCCTCGGG + Intronic
919881802 1:201905931-201905953 CCATCACCTCGGTCTTGCTTTGG - Intronic
919990349 1:202704911-202704933 CCCTGATGTTGGGTTTCCTTGGG - Intronic
921945092 1:220880497-220880519 CCCGGACCCCGGGCTGGCTTGGG + Intronic
922620517 1:226985443-226985465 CCCAGAGCCCGGGCCTCCTTGGG + Intronic
1066117060 10:32249854-32249876 TCCTGACCTCAGGCTTCCTGAGG - Intergenic
1067810093 10:49419340-49419362 CACTGACCTTGGGCGACCTTGGG - Intergenic
1072758727 10:98038537-98038559 CTCTGACCTCTGGCCTCCCTGGG - Intergenic
1075451906 10:122557469-122557491 CCCTGATCTCCGTCTTCCTCTGG + Intergenic
1076598976 10:131645020-131645042 CAGTGACCCCGGGCTGCCTTTGG + Intergenic
1077340904 11:2025905-2025927 CCCTGACCCCTGGCTTCTTGAGG + Intergenic
1077343605 11:2036701-2036723 CCCAGACTTGGGGCTTCCTTTGG + Intergenic
1079238435 11:18706013-18706035 CCATGACCTGCGCCTTCCTTGGG - Exonic
1080430848 11:32198296-32198318 CACTCACCTAGGGGTTCCTTGGG - Intergenic
1083330511 11:61896243-61896265 CCCAGACCTCCAACTTCCTTTGG + Intergenic
1083776159 11:64895209-64895231 CCCTGACCTCTGGCTTCCACAGG - Exonic
1084024385 11:66438703-66438725 CGCCGACCTCGGGCTTCCTGAGG + Exonic
1084518056 11:69647014-69647036 CCCTCACCTGGGGCTTCCTGGGG - Intronic
1085022038 11:73216109-73216131 CCCTTACCTGGGGCTGCCTGGGG - Intergenic
1085269816 11:75263591-75263613 CCCTGACCATGGGCTTCCTGAGG + Intergenic
1088561687 11:111121844-111121866 CCTTGTCCTCTGGCTTCCTATGG - Intergenic
1089787112 11:120915623-120915645 CCCTGTCCTCTGGCTTCCCTTGG + Intronic
1090080576 11:123609651-123609673 CCCGGCCCTCGGGCTCCCATTGG + Intronic
1202823889 11_KI270721v1_random:81094-81116 CCCTGACCCCTGGCTTCTTGAGG + Intergenic
1202826591 11_KI270721v1_random:91890-91912 CCCAGACTTGGGGCTTCCTTTGG + Intergenic
1091646133 12:2273795-2273817 CCCTGACCCCGGGCTTGGTTAGG + Intronic
1092792306 12:12080645-12080667 CCCTAACCAGGGGCTTGCTTGGG + Intronic
1096536064 12:52275590-52275612 GCCTGAGTTCAGGCTTCCTTTGG + Intronic
1096687834 12:53300437-53300459 CCCTGGCCTGGGACCTCCTTTGG + Intronic
1099799795 12:87442761-87442783 CCCTGACCAATGGCTACCTTTGG - Intergenic
1102515160 12:113441457-113441479 CCCTGCTCTCGGCATTCCTTGGG - Intergenic
1102583597 12:113907960-113907982 CCCTGACCTAGGGCCTCTCTGGG + Intronic
1103716932 12:122950356-122950378 CCCTGGCCCCTGTCTTCCTTAGG + Intronic
1104778111 12:131403156-131403178 GCCTGGCCACGGGCTGCCTTCGG - Intergenic
1105388748 13:19957754-19957776 GCCTGCCCTGGGGCGTCCTTGGG - Intergenic
1107884722 13:44865837-44865859 CCCTGCCCTCGCACTTCCTCTGG - Intergenic
1110543423 13:76730578-76730600 CCCTGATATCTGGCTTCCTTCGG - Intergenic
1112297453 13:98200671-98200693 CCCTGCCCTCGGGACTCCCTTGG + Intronic
1113896573 13:113768441-113768463 CCCAGAGCTGGGGCTTCCTGTGG + Intronic
1114394207 14:22342198-22342220 GCCTGAGTTTGGGCTTCCTTGGG + Intergenic
1118387178 14:65265518-65265540 CCCTGACCTGGGGCTTTTCTGGG + Intergenic
1119534764 14:75394055-75394077 CTCTGATCTCGGGCTGCCCTAGG + Intergenic
1119563696 14:75610812-75610834 CCCTGTCTGGGGGCTTCCTTAGG + Intronic
1120979717 14:90279123-90279145 CCCTCACCTCAGGTTTCCTTAGG - Exonic
1122997835 14:105275177-105275199 CCCTGGCCACCGGCTTCCTTGGG - Intronic
1202859656 14_GL000225v1_random:73173-73195 CCCCGTCCCCGGGCTTCCGTGGG + Intergenic
1124596609 15:31096760-31096782 CCCTGCCCTCGAGCCTCCTCTGG + Intronic
1132009622 15:98265051-98265073 CCCTGGCCATGGGCTTCCTGGGG + Intergenic
1132648880 16:1011569-1011591 CCCTCACCTGGGGCTTCCGGAGG + Intergenic
1134682249 16:16134387-16134409 CCCTGACCCTGGGCTTATTTCGG + Exonic
1136840764 16:33542836-33542858 CCCTGACCTGGCCCTGCCTTTGG - Intergenic
1138121070 16:54401507-54401529 CCCTAGCATCGGGCATCCTTGGG + Intergenic
1141711728 16:85703537-85703559 CCCTGACCACGGGCTTCACTGGG - Intronic
1203150929 16_KI270728v1_random:1843133-1843155 CCCTGACCTGGCCCTGCCTTTGG - Intergenic
1142549788 17:731962-731984 CCCGGACCTCACGCTTCCTGAGG + Intergenic
1145905572 17:28514490-28514512 CCCAGACCCCGAGTTTCCTTGGG + Intronic
1146287078 17:31581331-31581353 GCCAGCCCTCGGGCTTCCTTTGG + Intergenic
1146659456 17:34654680-34654702 CCCCGACCACTGGCTTACTTTGG + Intergenic
1147663314 17:42129240-42129262 CACTGACCTTGGGTTTCCTAAGG + Intronic
1148336897 17:46848035-46848057 CCCTGAGCGCTGGCTGCCTTGGG + Intronic
1148683371 17:49487073-49487095 CCCTGACCTCAGGCCGCCATGGG + Intergenic
1148742150 17:49898889-49898911 CCCTGACCTGGGCCCCCCTTGGG + Intergenic
1149010007 17:51846392-51846414 CCCTGAGCTGGGGCTGCCTATGG + Intronic
1152104762 17:78322582-78322604 CCCTGGTCTCAGGCTTGCTTGGG + Intergenic
1152615079 17:81334203-81334225 CCCTGCCCTCAGGCTTCCCTCGG + Intergenic
1153816963 18:8799057-8799079 CCCTGAACGCAGGCTTCCTAGGG - Intronic
1157649550 18:49313830-49313852 CCCTGACCCAGGGCTAACTTTGG + Intronic
1160969619 19:1761751-1761773 ACCTGACCTTGGGCAGCCTTGGG + Intronic
1161724236 19:5919125-5919147 CCCTGCCCTCTGGTTTCCTTAGG + Intronic
1161853772 19:6752701-6752723 CCCTGACCACCGGCTTCGTGCGG - Exonic
1161911657 19:7198558-7198580 CCCTGACCCCAGGCCTCCCTCGG + Intronic
1161997093 19:7719882-7719904 TCCTGACCTGGAGCTCCCTTGGG + Intergenic
1162950565 19:14069835-14069857 CCTTCCCCTCTGGCTTCCTTGGG - Intergenic
1163526541 19:17824856-17824878 CCCTGACCTCAGGGTTCCTTGGG - Exonic
1167498156 19:49831106-49831128 CCCAGACCCAGGGATTCCTTGGG - Intronic
927249875 2:20988106-20988128 GCCTGACCTCAGGCCTCCCTGGG + Intergenic
927395856 2:22650536-22650558 CTCTGAAGTTGGGCTTCCTTGGG + Intergenic
931860181 2:66346403-66346425 CCATGACCCTGGGCCTCCTTGGG + Intergenic
932439275 2:71721563-71721585 CCCTGACCTTGGGTTCCCTGAGG - Intergenic
932588319 2:73045941-73045963 CCCTGACCTCTAGTTGCCTTAGG + Intronic
932803666 2:74765031-74765053 CCTTGATCTCAGGCTTCCTATGG - Intergenic
934737067 2:96695011-96695033 CCCTGACTTTGGGCCTCCTCGGG - Intergenic
935444558 2:103142175-103142197 CCCAGCCCTCTGGCTGCCTTTGG + Intergenic
935617674 2:105102847-105102869 CCATGAGCTCGGGGTTCCTGAGG - Intergenic
935690769 2:105730390-105730412 CCCTGAGCTCTGGGTTCCTCAGG - Intergenic
938094966 2:128455648-128455670 ACCTGCCCTGGGGTTTCCTTTGG - Intergenic
938986761 2:136584108-136584130 CCCTGACCTGGGGCCTCTTCAGG - Intergenic
940094074 2:149953602-149953624 CCCTGACCTCAGCCATCCTTGGG - Intergenic
940840452 2:158573982-158574004 GCCTTTCCTTGGGCTTCCTTGGG + Intronic
947542755 2:230990279-230990301 CTCTGGGCTCGGGCTTCCGTTGG - Intergenic
948189477 2:236046731-236046753 CCCTGACCTCAGGGCTCCTGTGG - Intronic
948808524 2:240463261-240463283 CCCTACCCTGGGGCTTCGTTAGG + Intronic
1170518183 20:17153548-17153570 CCCTGACCTCTGAATTTCTTGGG + Intergenic
1170596409 20:17809164-17809186 CCCTGAACTTGGGCTGCCTCCGG - Intergenic
1172125503 20:32623024-32623046 CCCTGACCTCTCCCTTCCCTAGG - Intergenic
1172424352 20:34845219-34845241 CCCTGATCTGGGGCATCCCTGGG + Exonic
1173732201 20:45336807-45336829 CCCTGACCTGAGGCTGTCTTAGG - Intronic
1174453313 20:50632833-50632855 CTCTGACATCGGGCATCCTCGGG - Intronic
1175783663 20:61698845-61698867 GCCTGATGTCGGGCTGCCTTGGG + Intronic
1175953091 20:62593820-62593842 CCCCAACCTGGGGCATCCTTTGG + Intergenic
1176046820 20:63097148-63097170 TCCTGACCTTGGGCTTCCCTGGG - Intergenic
1179142593 21:38739764-38739786 CCCTGATGTCTGGTTTCCTTAGG - Intergenic
1181879426 22:25966205-25966227 ACCTGACTTTGGGCTTCCTAAGG - Intronic
1183482306 22:38071832-38071854 GCCTGACCTCAGGCTCCCTCTGG + Intronic
1183490097 22:38111433-38111455 CCCTGACCCCCGGCTCCCCTCGG - Intergenic
1184388222 22:44188200-44188222 CCCTGCCCTCGGGCTGCCCTAGG + Intronic
1184711101 22:46250033-46250055 CCCTGACCTCGGGCAGCGCTGGG - Intronic
950052967 3:10005982-10006004 CCCTGACATCTGGCTTTCTTCGG - Intronic
950654218 3:14426786-14426808 CCCTGCCCTAGAGCTTCCTGCGG + Intronic
950815311 3:15695304-15695326 CCCTAAACCCGTGCTTCCTTTGG + Intronic
952201613 3:31134772-31134794 CCCTGACCTGGGGCTTAGATAGG - Intergenic
954082783 3:48222245-48222267 CCCTGGCCTCGGGTTTCCCTGGG - Intergenic
954156360 3:48686860-48686882 TCCTGGGCTCGGGCTTCCTGTGG - Intergenic
959442775 3:106398947-106398969 CCCTGACTTCTGTTTTCCTTTGG + Intergenic
959608084 3:108263872-108263894 TCCTGACCTCAGGCTTCCTGAGG - Intergenic
961208885 3:125110012-125110034 CCCTGTCCTCTGGCTGGCTTAGG - Intronic
961264816 3:125633344-125633366 CCCTGACCTCTGAGTTCCTGGGG + Intergenic
961426410 3:126851854-126851876 TCCTGACCTCCAGCTTCCTCAGG - Intronic
961465503 3:127078643-127078665 CTCTGACCACGGTCTGCCTTTGG - Intergenic
961546821 3:127640113-127640135 CCTAGGCCTCGGGCTTTCTTCGG - Intronic
965788697 3:172364327-172364349 CCCAGACCTGTGGCTTCCATTGG + Intronic
966933766 3:184692177-184692199 CCTGGACTTCGGGCTCCCTTTGG + Intergenic
968972301 4:3802395-3802417 CCCTGACCCCTGGCTTTCTGGGG + Intergenic
972425501 4:38928969-38928991 CCCTGACCTCTTGTTGCCTTTGG + Intronic
972738759 4:41870564-41870586 AACTGACCTTGTGCTTCCTTTGG + Intergenic
974545295 4:63298244-63298266 CCCTGCTTTCTGGCTTCCTTAGG + Intergenic
991930665 5:71750282-71750304 CCCTGACTTCTGGCTACCTCAGG - Intergenic
995455280 5:112345121-112345143 GCCTGACCACAGGCTCCCTTTGG + Intronic
998426986 5:142037074-142037096 CGCCGACCTCGGGCTTCCTGAGG + Intergenic
999088032 5:148910776-148910798 CCCTGACCTGGTGGTTCCTGAGG + Intergenic
1000295820 5:159912507-159912529 CCCTGACCTCTGCCTTACTAAGG + Intergenic
1005956268 6:30665477-30665499 ACCTGTCCTCGGGTTTCCTTGGG + Exonic
1006012442 6:31054178-31054200 CCCGGAGCTCTGGCTTCCCTCGG + Intergenic
1006794960 6:36726046-36726068 CCCTGACCTCCTGAATCCTTGGG - Intronic
1007963836 6:45985620-45985642 CCCTGCCCTCTGGCTGCATTAGG + Intronic
1008501738 6:52190391-52190413 CCCTAGACTCAGGCTTCCTTTGG + Exonic
1015806900 6:137118908-137118930 GCCTGACCTCGGGGTCCCCTGGG - Intergenic
1017997000 6:159540919-159540941 CTCTGGCCTCAGGCCTCCTTGGG + Intergenic
1022487878 7:30794408-30794430 CCCTCTCCTCCAGCTTCCTTAGG - Intronic
1023083862 7:36550580-36550602 TCCTGAGCTCTGGCTTCCTGTGG + Intronic
1024009889 7:45258692-45258714 CCCTGACCTCAGCCTCCCTGAGG - Intergenic
1025032266 7:55567605-55567627 CCCAGACCTGGGGCTTTCCTTGG - Intronic
1026674228 7:72415852-72415874 CCTTCACCTAGGGCTTCCTTTGG + Intronic
1029700896 7:102246295-102246317 CCCTTCCCTGGGGCTACCTTGGG - Intronic
1030065575 7:105656392-105656414 CCCTGACCTCTGGCTCCCACAGG + Intronic
1031067276 7:117118664-117118686 CCCTGACTGGGGGTTTCCTTAGG - Intronic
1031816602 7:126445591-126445613 CCCTTTCCTTGGGCTTCCTGAGG - Intronic
1032082398 7:128866210-128866232 CCCTGGCCTCAGGCTGCCTCAGG + Intronic
1033684238 7:143624034-143624056 CCCTGTCCTGGGGCTCCCGTGGG + Intronic
1033687415 7:143703253-143703275 CCCTGTCCTGGGGCTCCCGTGGG + Exonic
1033700373 7:143833589-143833611 CCCTGTCCTGGGGCTCCCGTGGG - Intergenic
1033727065 7:144129982-144130004 CCTTGACCTCTGCATTCCTTAGG - Exonic
1035082437 7:156228197-156228219 TCTTGTCCTGGGGCTTCCTTTGG - Intergenic
1038311376 8:26448836-26448858 CCCTGCCCTCGGCCTTGCGTGGG + Intronic
1039312114 8:36328006-36328028 CCCTGCCTTCGTGCTTCCTTAGG + Intergenic
1049391665 8:142374854-142374876 CGCTGGCCTCGGGCTGCCCTGGG + Intronic
1052597205 9:30575404-30575426 CCCAGAACTCGGGATTCCCTGGG + Intergenic
1058884429 9:109312806-109312828 CCCTGGGCTCCGGGTTCCTTGGG - Intronic
1058976960 9:110133745-110133767 CCCTCACCCCTGGCTTCTTTTGG - Intronic
1059459253 9:114419533-114419555 TCTTGCCCCCGGGCTTCCTTTGG - Intronic
1061725203 9:132578798-132578820 CCCAGACCTCGGCTTTCCCTTGG - Intergenic
1061783166 9:133007732-133007754 CCCTGACCCCTTGATTCCTTGGG - Intergenic
1061806817 9:133141444-133141466 CCCTGCCCTTGGGCTCCCATAGG - Intronic
1061818526 9:133209772-133209794 CCCTGCACTCGAGCTTCCTAGGG + Intergenic
1061890036 9:133614335-133614357 TCCTGGCCTCGGGCAGCCTTGGG - Intergenic
1062111616 9:134785153-134785175 CCATGGCCTCGGGCTCCCGTTGG + Intronic
1062241925 9:135545590-135545612 CCCTGCACTCGAGCTTCCTAGGG - Intergenic
1062376452 9:136263967-136263989 CCATGGCCTTGGGCTTCCCTGGG + Intergenic
1190597593 X:52063734-52063756 CTCTGAGCTCCGGGTTCCTTAGG + Exonic
1190611231 X:52190339-52190361 CTCTGAGCTCCGGGTTCCTTAGG - Exonic
1195160988 X:102171153-102171175 CTCTGATCCCGGGCTTCTTTTGG + Intergenic
1196669120 X:118346718-118346740 CCCAGACCTGGGGCTTCTTAGGG + Intronic
1199627076 X:149750630-149750652 CCCCAACCTGGGGCTTCCCTGGG - Intergenic
1199765909 X:150941608-150941630 CCCTGACCTTGGCCATCCTGTGG - Intergenic
1199882979 X:151990281-151990303 CCCTGACCTCTTGCTTCCCTGGG + Intergenic
1200385121 X:155882414-155882436 CCCTGACCTCTGACTTTCTTAGG - Intronic