ID: 904750759

View in Genome Browser
Species Human (GRCh38)
Location 1:32740544-32740566
Sequence CAGGATTACTAGAGTGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 261}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904750759_904750769 28 Left 904750759 1:32740544-32740566 CCCACTGCACTCTAGTAATCCTG 0: 1
1: 0
2: 0
3: 16
4: 261
Right 904750769 1:32740595-32740617 GCGCCGGGGCTGACTGGGCTGGG 0: 1
1: 0
2: 3
3: 19
4: 239
904750759_904750763 12 Left 904750759 1:32740544-32740566 CCCACTGCACTCTAGTAATCCTG 0: 1
1: 0
2: 0
3: 16
4: 261
Right 904750763 1:32740579-32740601 GAGTGCTATCTACAGTGCGCCGG 0: 1
1: 0
2: 0
3: 0
4: 42
904750759_904750767 23 Left 904750759 1:32740544-32740566 CCCACTGCACTCTAGTAATCCTG 0: 1
1: 0
2: 0
3: 16
4: 261
Right 904750767 1:32740590-32740612 ACAGTGCGCCGGGGCTGACTGGG 0: 1
1: 0
2: 0
3: 6
4: 68
904750759_904750765 14 Left 904750759 1:32740544-32740566 CCCACTGCACTCTAGTAATCCTG 0: 1
1: 0
2: 0
3: 16
4: 261
Right 904750765 1:32740581-32740603 GTGCTATCTACAGTGCGCCGGGG 0: 1
1: 0
2: 0
3: 0
4: 19
904750759_904750764 13 Left 904750759 1:32740544-32740566 CCCACTGCACTCTAGTAATCCTG 0: 1
1: 0
2: 0
3: 16
4: 261
Right 904750764 1:32740580-32740602 AGTGCTATCTACAGTGCGCCGGG 0: 1
1: 0
2: 0
3: 3
4: 50
904750759_904750768 27 Left 904750759 1:32740544-32740566 CCCACTGCACTCTAGTAATCCTG 0: 1
1: 0
2: 0
3: 16
4: 261
Right 904750768 1:32740594-32740616 TGCGCCGGGGCTGACTGGGCTGG 0: 1
1: 0
2: 1
3: 18
4: 213
904750759_904750766 22 Left 904750759 1:32740544-32740566 CCCACTGCACTCTAGTAATCCTG 0: 1
1: 0
2: 0
3: 16
4: 261
Right 904750766 1:32740589-32740611 TACAGTGCGCCGGGGCTGACTGG 0: 1
1: 0
2: 0
3: 4
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904750759 Original CRISPR CAGGATTACTAGAGTGCAGT GGG (reversed) Intergenic
900865770 1:5267671-5267693 CAGGACTGCAAGAGTCCAGTGGG - Intergenic
902525933 1:17057411-17057433 GAGGATTGCTTGAGTGCAGGAGG + Intergenic
903492493 1:23740129-23740151 CAGGATTACTTGAGCCCAGGAGG + Intergenic
904750759 1:32740544-32740566 CAGGATTACTAGAGTGCAGTGGG - Intergenic
905589473 1:39150105-39150127 GAGGATTGCTTGAGTGCAGGAGG - Intronic
905984950 1:42271736-42271758 AAGGATTACTAGAGCCCAGGAGG - Intronic
906046047 1:42831671-42831693 CAGGATTACTTGAGCCCAGGTGG - Intronic
907031877 1:51180476-51180498 GAGGATCACTTGAGTGCAGGAGG - Intergenic
907084563 1:51658016-51658038 GAGGATCACTTGAGTGCAGGAGG + Intronic
907174035 1:52500841-52500863 CAGGATCACTTCAGTGCAGGAGG + Intronic
909162638 1:72173094-72173116 GAGGATTGCTTGAGTGCAGGAGG - Intronic
910487819 1:87735045-87735067 AAGGATTAATAGAGGGCTGTAGG + Intergenic
911679415 1:100697609-100697631 GAGGACTACTAGAGTGAAGAGGG - Intergenic
912026155 1:105176747-105176769 AAGGATTACTTGAGTCCAGCAGG + Intergenic
914781529 1:150790016-150790038 GAGGATCACTTGAGTGCAGGAGG + Intergenic
915108017 1:153546383-153546405 CAGGAGTTCGAGACTGCAGTTGG + Intronic
917132053 1:171753103-171753125 CAGGATCACTTGAGTGCAGGAGG - Intergenic
918319974 1:183355067-183355089 CAGCATGGCTACAGTGCAGTGGG - Intronic
918702284 1:187620386-187620408 TAGGATCACTGGAGTGCAGGAGG - Intergenic
918794825 1:188880354-188880376 CAGGAGTTCTAGGCTGCAGTGGG - Intergenic
918935311 1:190914011-190914033 CAGGATGATTACAGTGGAGTTGG + Intergenic
920746799 1:208636574-208636596 AAGGATTACTAGAAGCCAGTTGG + Intergenic
921224733 1:213007002-213007024 GAGGATTACTTGAGCCCAGTAGG + Intronic
921910412 1:220542823-220542845 CAGAATTTCTACAGTGCAGTAGG - Intronic
923330374 1:232918134-232918156 CAGGACTAATAGAGTGGATTTGG - Intergenic
924463634 1:244281516-244281538 CAGGATGGGTGGAGTGCAGTGGG - Intergenic
1065485161 10:26230076-26230098 CAGAATTACTTGAGTTCAGGAGG + Intronic
1066073900 10:31852545-31852567 CAATATTACTACAGTGCAGACGG - Exonic
1066350383 10:34631691-34631713 GAGGATTGCTTGAGTGCAGGAGG - Intronic
1068008363 10:51417333-51417355 CAGGAATACTGGATTCCAGTGGG - Intronic
1068324273 10:55463567-55463589 TAGGATCACTTGAGTCCAGTAGG + Intronic
1069100596 10:64315766-64315788 AAGGCTTAACAGAGTGCAGTAGG - Intergenic
1070317518 10:75329553-75329575 GAGGATCACTTGAGTGCAGGAGG - Intergenic
1071103686 10:82069171-82069193 CAGGCCTACTAGGGTGCAGATGG + Intronic
1072967373 10:99985838-99985860 GAGGATCACTTGAGTGCAGGAGG - Intronic
1073064159 10:100748611-100748633 CAGGATTTCTAGACTGCTGTAGG + Intronic
1073803796 10:107072974-107072996 CAGGGTTACTAGAGTTCACTGGG + Intronic
1074601361 10:114917124-114917146 CAGGATTAATAGATAGCTGTTGG + Intergenic
1075059789 10:119248099-119248121 GAGGATTGCTAGAGTCCAGGAGG - Intronic
1075107692 10:119552624-119552646 CAGGGTAACAGGAGTGCAGTGGG + Intergenic
1076001746 10:126918166-126918188 CAGGATCACCAGCGTGCAGCGGG + Intronic
1078695816 11:13630419-13630441 GAGGATTACTTGAGTCCAGGAGG - Intergenic
1078768409 11:14322348-14322370 GAGGATCACTTGAGTGCAGGAGG + Intronic
1081735674 11:45401816-45401838 TATTATTATTAGAGTGCAGTGGG + Intergenic
1083062933 11:59893453-59893475 GAGGATTACTTGAGTCCAGGAGG - Intergenic
1083838185 11:65286426-65286448 CAGTCTCACTGGAGTGCAGTGGG + Intronic
1084067393 11:66712917-66712939 CAGGAGTTCTAGGCTGCAGTGGG - Intronic
1084859585 11:72009538-72009560 CAGGTTTAGTAGACTGTAGTCGG - Intronic
1085532489 11:77200179-77200201 AAGGATTACTTGAGTCCAGGAGG + Intronic
1087235964 11:95718984-95719006 GAGAATTACTAGAGTCCAGGAGG - Intergenic
1087586223 11:100125324-100125346 GAGGATTACTAGAGGGAAGTAGG - Intronic
1089981388 11:122775679-122775701 GAGGATTGCTTGAGTGCAGGAGG + Intronic
1091428144 12:409604-409626 GAGGATTGCTTGAGTGCAGGAGG - Intronic
1092782931 12:12004078-12004100 GAGGATCACTTGAGTGCAGGAGG - Intergenic
1093316976 12:17664450-17664472 CAGGAGTTCAAGATTGCAGTAGG + Intergenic
1095281605 12:40357860-40357882 GAGGATCACTTGAGTGCAGAAGG - Intronic
1095984180 12:47988718-47988740 GAGGATTACTAGAGGCCAGTGGG - Intronic
1096047288 12:48573576-48573598 CAGGAGTTCAAGAATGCAGTGGG + Intergenic
1096687333 12:53297102-53297124 CAGGAATAGTAGTGTGTAGTAGG + Intronic
1098788678 12:74792185-74792207 AAGAATTACTAGAATGCATTAGG - Intergenic
1099794253 12:87377484-87377506 AAGGATCACTTGAGTGCAGGAGG + Intergenic
1101275169 12:103191649-103191671 GAGGATTACTAGAGACCAGGAGG + Intergenic
1101392531 12:104315075-104315097 GGGGATGATTAGAGTGCAGTGGG - Intronic
1103263909 12:119612828-119612850 GAGGATCACTAGAGTACAGGAGG + Intronic
1105402885 13:20111114-20111136 CAGGATTAATAGGATGCAGCTGG - Intergenic
1105490610 13:20884285-20884307 CAGGATTACTTGAGCTCAGGAGG + Intronic
1105492833 13:20904082-20904104 CAGGAGGTCGAGAGTGCAGTGGG + Intergenic
1106448617 13:29859635-29859657 GAGGATCACTAGAGTCCAGGAGG - Intergenic
1108239518 13:48447728-48447750 CGGGAAAACTATAGTGCAGTAGG - Intronic
1108505600 13:51109662-51109684 CAGGATCACTTGAGTCCAGGAGG + Intergenic
1110693936 13:78464785-78464807 GAGGATCACTTGAGTGCAGAAGG + Intergenic
1111499300 13:89094669-89094691 AAGGATTGCTTGAGTCCAGTAGG + Intergenic
1111826031 13:93268917-93268939 CAGGATTCCTAGAGAACAGGAGG - Intronic
1116878808 14:50143249-50143271 CAGGAGTTCGAGACTGCAGTGGG + Intronic
1116980792 14:51167958-51167980 AAGGCTTTCTAAAGTGCAGTTGG + Intergenic
1117122560 14:52584044-52584066 GAGGAATACTAGAATGGAGTGGG - Intronic
1117359717 14:54960871-54960893 CAGGAGTTCGAGGGTGCAGTAGG - Intronic
1117402306 14:55369549-55369571 AATGTTTACTAGAGTGTAGTGGG + Exonic
1119008122 14:70953203-70953225 CAGGAGTTCAAGAGTTCAGTGGG + Intronic
1119384649 14:74250145-74250167 GAGGATTACTTGAGTCCAGGAGG + Intronic
1120360436 14:83494286-83494308 GAGGATTACTTGAGCTCAGTAGG - Intergenic
1120461021 14:84795525-84795547 GAGGATTGCTAGAGTTCAGGAGG - Intergenic
1120868562 14:89317064-89317086 CAGGATTTCAAGACTGCAATTGG + Intronic
1121555973 14:94837523-94837545 CAGTATTTCTAGAATGCAGATGG - Intergenic
1124354016 15:28981988-28982010 AAGGACTACTAGAGGGCAGAGGG + Intronic
1125841817 15:42808808-42808830 CAGCAAGGCTAGAGTGCAGTTGG - Intronic
1126076920 15:44920408-44920430 CAGGCTTTCTTGATTGCAGTTGG - Intergenic
1126081791 15:44970422-44970444 CAGGCTTTCTTGATTGCAGTTGG + Intronic
1128779869 15:70352253-70352275 CTGGCTTTCTAGGGTGCAGTGGG + Intergenic
1129007567 15:72386884-72386906 CAGGATTGCTTGAGTCCAGGAGG - Intergenic
1129808850 15:78489603-78489625 CAGGATTGCTTGAGTCCAGGAGG - Intronic
1130988124 15:88857984-88858006 CAGGGTTACCAGGGTTCAGTGGG + Exonic
1135380813 16:21994918-21994940 GAGGATCACTTGAGTGCAGGAGG - Intronic
1135735570 16:24929237-24929259 CAGGAGTTCGAGACTGCAGTGGG - Intronic
1135868830 16:26130071-26130093 CAGGACCAGGAGAGTGCAGTGGG + Intronic
1138145033 16:54601335-54601357 GAGGATTACTTGAGTGGAGGAGG - Intergenic
1140498075 16:75407450-75407472 CAGGATCACTTGAGTCCAGGAGG + Intronic
1140526155 16:75624597-75624619 CAGTACTACTACAGTGTAGTGGG + Intergenic
1141309150 16:82896379-82896401 GAGGATTACTTGAGTCCAGGAGG - Intronic
1141780501 16:86157207-86157229 CAGGAGTTCAAGATTGCAGTGGG + Intergenic
1143028696 17:3955363-3955385 CTGGATTCCTACAGTCCAGTGGG - Intronic
1146638816 17:34525329-34525351 CAGGATCACTAGAGTCAAGCAGG + Intergenic
1146696036 17:34909679-34909701 CTGGGTTACTAGAGTCCAGATGG - Intergenic
1146773927 17:35595455-35595477 GAGGATCACTTGAGTGCAGGAGG + Intronic
1147503746 17:40992861-40992883 CAGTATTAGTAAAGTGCTGTGGG - Intergenic
1147842349 17:43380757-43380779 GAGGATAACTTGAGTCCAGTAGG + Intergenic
1149087816 17:52740245-52740267 CAGGAGTTCTAGGCTGCAGTGGG + Intergenic
1149636608 17:58175970-58175992 GAGGATTACTTGAGTCCAGGAGG - Intergenic
1149835386 17:59907626-59907648 CAGGATCACTTGAGTGCAGGAGG - Intronic
1152170838 17:78746901-78746923 CACGAAGACTGGAGTGCAGTGGG - Intronic
1152769594 17:82158962-82158984 GAGGATTACTTGAGCCCAGTGGG - Intronic
1153512424 18:5870076-5870098 CCTGACTACTAGAATGCAGTGGG - Intergenic
1153704253 18:7728982-7729004 CAGGAATTCAAGACTGCAGTGGG - Intronic
1154935278 18:21048637-21048659 GAGGATTACTTGAGTCCAGGAGG - Intronic
1156217624 18:35015956-35015978 GGGGACTACTAGAGTGCAGAAGG - Intronic
1159744404 18:72213176-72213198 TAGGATTACTAGAATCCATTTGG + Intergenic
1162078403 19:8204496-8204518 GAGGATTACTTGAGTCCAGGAGG - Intronic
1163652682 19:18527678-18527700 GAGAATCACTTGAGTGCAGTGGG + Intergenic
1165560908 19:36678800-36678822 CTGGAGTGCTGGAGTGCAGTGGG - Intergenic
1165781978 19:38440200-38440222 CAGGATTGCTTGAGTCCAGGAGG + Intronic
1165889496 19:39102028-39102050 GAGGATTGCTTGAGTGCAGGAGG + Intronic
1165979445 19:39707247-39707269 CAGGATGACCAAAGTGCAGTCGG - Exonic
926205289 2:10831102-10831124 CGGGATTCCTTGACTGCAGTGGG + Intronic
926381737 2:12297302-12297324 CACCATTACCAGAGTGCAGATGG + Intergenic
928567322 2:32566440-32566462 CAGGATCACTTGAGTCCAGGAGG - Intronic
930840271 2:55837760-55837782 GAGGATTACTTGAGTCCAGGAGG - Intergenic
931727000 2:65121142-65121164 GAGGATCACTAGAGTACAGGAGG + Intronic
932543118 2:72677972-72677994 GAGGATTGCTAGATTGCAGTAGG + Intronic
935053602 2:99545445-99545467 TAGGATTTTTAGAGTGCTGTTGG - Intronic
935640738 2:105287633-105287655 GAGGATTAAGAGAGTGCAGCTGG + Intronic
938203147 2:129393597-129393619 CAGGAGTTCCAGATTGCAGTGGG + Intergenic
938309710 2:130281016-130281038 CTATATTACTAGAGTGGAGTAGG - Intergenic
939787778 2:146538252-146538274 CAGGATTATTAGAGTTAGGTTGG + Intergenic
939942768 2:148370576-148370598 CAGGATCACTTGAGCCCAGTGGG - Intronic
942386427 2:175448129-175448151 TATTATTACTAGAGTGCATTGGG + Intergenic
943786401 2:191882350-191882372 CAGGAGTAAAGGAGTGCAGTTGG + Intergenic
943846232 2:192652583-192652605 CAGGATCACTTGAGTCCAGGAGG + Intergenic
943980048 2:194538611-194538633 GAGGACTACTAGAGTGCAGAGGG - Intergenic
944197760 2:197073343-197073365 CAGGATTCCTAGTGTGGAGAGGG - Intronic
947759158 2:232590837-232590859 GAGGATTACGTGAGTGCAGGAGG - Intergenic
948191026 2:236058954-236058976 CAGGATTTCAAGGCTGCAGTGGG + Intronic
948210578 2:236190278-236190300 CAGGATCCCTTGAGTGCAGAAGG + Intergenic
948301783 2:236912990-236913012 CAGAAGTAAAAGAGTGCAGTTGG - Intergenic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1171447001 20:25212032-25212054 CAGGATTACTTGAGCCCAGGAGG - Intronic
1171753227 20:29076155-29076177 CAGGACTACTAGAGGGGAGAAGG - Intergenic
1171789027 20:29501405-29501427 CAGGACTACTAGAGGGGAGAAGG + Intergenic
1171858501 20:30373093-30373115 CAGGACTACTAGAGGGGAGAAGG - Intergenic
1172037379 20:32019372-32019394 CAGGATGACCAGGTTGCAGTAGG - Exonic
1172715075 20:36956878-36956900 GAGGATCACTTGAGTGCAGGAGG + Intergenic
1174492461 20:50910511-50910533 CAGGAGTTCAAGACTGCAGTGGG + Intronic
1177284521 21:19032484-19032506 CAGGAGTACTAGAGTGTCTTAGG - Intergenic
1178223026 21:30682730-30682752 GAGGATTACTAGAGTGGGGAAGG - Intergenic
1178263559 21:31121749-31121771 CTGGCTTCCTAGAGGGCAGTAGG - Intronic
1179314611 21:40231590-40231612 GAGGATCACTTGAGTGCAGGAGG - Intronic
1179543508 21:42099768-42099790 CAGGATCACTTGAGTCCAGGGGG - Intronic
1182467761 22:30528511-30528533 GAGGATTACTGGAGTCCAGGAGG - Intronic
1182791843 22:32959682-32959704 GAGGATTGCTTGAGCGCAGTAGG - Intronic
1183945118 22:41321137-41321159 CAGGATTGCTTGAGTCCAGGAGG - Intronic
1184564092 22:45281230-45281252 CAGGATTGCTTGAGTCCAGGAGG + Intergenic
953607342 3:44420453-44420475 CAGGAACACTAGAGAGGAGTGGG - Intergenic
954262781 3:49451745-49451767 CAGGAGTTCAAGACTGCAGTGGG + Intergenic
957980832 3:87508701-87508723 GAGGATTACTTGAGTCCAGGAGG + Intergenic
960200784 3:114833617-114833639 GAGGATTACTTGAGTCCAGGAGG - Intronic
960632753 3:119749432-119749454 GAGGATCACTTGAGTGCAGGAGG + Intronic
961077446 3:123995168-123995190 GAGGAATCTTAGAGTGCAGTTGG - Intergenic
961212165 3:125133903-125133925 AGGGATTACTAAAGTGCAGAAGG - Intronic
961854731 3:129858458-129858480 GAGGATGACTAGAGTCCAGGAGG - Intronic
962107028 3:132401118-132401140 CAGGAGTTCGAGGGTGCAGTAGG + Intergenic
962766617 3:138569776-138569798 AAGGATCACTTGAGTGCAGGAGG + Intronic
963776240 3:149444169-149444191 CAGGTCCACTAGAGTCCAGTGGG - Intergenic
963988712 3:151628248-151628270 GAGGATTGCTAGAGTTCAGCAGG - Intergenic
964086033 3:152819649-152819671 GAGGATTACTTGAGCCCAGTAGG - Intergenic
967469782 3:189848322-189848344 GAGGATCACTTGAGTGCAGCAGG - Intronic
968174619 3:196538558-196538580 GAGGATCACTAGAGTCCAGGAGG - Intergenic
968765508 4:2466560-2466582 CAGGATTACTTGAGCCCAGGAGG - Intronic
970109451 4:12620944-12620966 CAGGAATACTAGAATGGTGTGGG + Intergenic
970851340 4:20606390-20606412 CAGGATCACTTGAGTCCAGGAGG + Intronic
971338055 4:25742408-25742430 CAAGATTGCTTGAGTGCAGGAGG - Intergenic
971761060 4:30765875-30765897 GAGGTTTACTAGAAGGCAGTCGG + Intronic
972693557 4:41422845-41422867 GAGGATTACTTGAGTCCAGGAGG - Intronic
972860109 4:43157974-43157996 CTGCATTCCTAGAGTGCGGTTGG + Intergenic
973142824 4:46790669-46790691 CAGGAATACTAAAGTCCAGGTGG - Intronic
973706885 4:53589785-53589807 CAGATTGACTAGAATGCAGTTGG - Intronic
973985503 4:56348342-56348364 GAGGATCACTAGAGCCCAGTAGG - Intronic
980138054 4:128880077-128880099 CAGGATTACTAGATTACATCTGG + Intronic
980570401 4:134608647-134608669 CAGGATCACTTGAGCCCAGTAGG + Intergenic
984085617 4:175307114-175307136 CCTGATTCTTAGAGTGCAGTGGG + Intergenic
984132014 4:175889433-175889455 GAGGATGACTTGAGTTCAGTAGG + Intronic
989228362 5:39056545-39056567 CAGGATCACTTGAGTCCAGGAGG + Intronic
990580467 5:57162951-57162973 CATGAAACCTAGAGTGCAGTGGG + Intergenic
991308140 5:65203313-65203335 CAGGAGTTCTAGGCTGCAGTGGG + Intronic
991996702 5:72394818-72394840 CTGGGTTCCTACAGTGCAGTGGG - Intergenic
992686771 5:79207000-79207022 CAGGATCACTTGAGCGCAGGAGG + Intronic
992891208 5:81206089-81206111 CAGGAAAACTGGAGTCCAGTAGG - Intronic
994603417 5:101937002-101937024 GAGGATTACTAGAGGGCGGAGGG - Intergenic
996558998 5:124808456-124808478 GAGGATTACTTGAGTTCAGGAGG + Intergenic
996657352 5:125957229-125957251 CAGGATAACTAGAGTGGTATTGG - Intergenic
997177457 5:131794140-131794162 GAGGATTACTAGAGCCCAGGAGG + Intronic
997450047 5:133975176-133975198 CAGGATTACTTGAGCACAGGAGG + Intronic
997972219 5:138412733-138412755 AAGGATCACTAGAGTCCAGCAGG + Intronic
998232404 5:140369223-140369245 CAGGAGTTTGAGAGTGCAGTAGG + Intronic
999269459 5:150288342-150288364 GAGTATTACAAGAGTGCTGTTGG - Intronic
999397586 5:151239888-151239910 CAGGATTATTTGAGTTTAGTAGG - Intronic
1002013028 5:176299317-176299339 CAGGAGTTCTAGGCTGCAGTAGG + Intronic
1002214812 5:177623425-177623447 CAGGAATTCTAGGCTGCAGTAGG - Intergenic
1002837237 6:875147-875169 CACCTTTTCTAGAGTGCAGTGGG - Intergenic
1003704694 6:8512173-8512195 GAGGATTGCTTGAGTCCAGTGGG + Intergenic
1004633396 6:17443176-17443198 CAGGAGTTCTAGGCTGCAGTGGG + Intronic
1004974291 6:20947499-20947521 CAGGATCACTTGAGTCCAGGAGG + Intronic
1005065032 6:21809345-21809367 CAGATTTAATAGAGTGCAGAGGG - Intergenic
1005087673 6:22023545-22023567 GAGGATTGCTTGAGTGCAGGAGG - Intergenic
1006371513 6:33647111-33647133 CAGGATTGCTTGAGTCCAGGAGG - Intronic
1008622659 6:53286487-53286509 CAGGAGTTCTAGGCTGCAGTGGG + Intronic
1011642804 6:89431701-89431723 CAGGAGTTCAAGACTGCAGTGGG + Intergenic
1013798981 6:113918727-113918749 GAGGATCACTTGAGTGCAGGAGG + Intergenic
1015540111 6:134305317-134305339 CAGGCTGGCTGGAGTGCAGTGGG - Intronic
1016551892 6:145290530-145290552 CTGGATTACAATAGTGGAGTTGG + Intergenic
1017022209 6:150149364-150149386 CAGGCTAGCTAGAGTGCAGTGGG + Intronic
1018793921 6:167171543-167171565 CTGGATGACCAGAGTGCATTCGG + Intronic
1018822411 6:167383537-167383559 CTGGATGACCAGAGTGCATTCGG - Intronic
1020014242 7:4821553-4821575 CAGGATTTCTGAAATGCAGTAGG - Intronic
1020170395 7:5840472-5840494 GAGGATCACTTGAGTGCAGGAGG + Intergenic
1021377595 7:19927125-19927147 CAGGTTTACTAGAGGCAAGTAGG + Intergenic
1023377672 7:39574813-39574835 GAGGATCACTTGAGTGCAGAAGG + Intronic
1023390965 7:39711343-39711365 GAGGATCACTAGAGTCCAGGAGG - Intergenic
1023429322 7:40073413-40073435 GAGGATTGCTGGAGTCCAGTAGG + Intronic
1024614557 7:51100032-51100054 CAGGATTACCACAGTGGAGGTGG - Intronic
1025194786 7:56924353-56924375 CATGATTAATAGAGTGCTGAGGG - Intergenic
1025677166 7:63652590-63652612 CATGATTAATAGAGTGCTGAGGG + Intergenic
1025748043 7:64263179-64263201 AAGGATTACTTGAGTCCAGGAGG - Intronic
1025825918 7:65010394-65010416 CAGGAGTTCTAGGCTGCAGTGGG - Intergenic
1025898909 7:65728179-65728201 CAGGAGTTCTAGGCTGCAGTGGG - Intergenic
1025936652 7:66043380-66043402 CAGGATTGCTTGAGTCCAGAAGG + Intergenic
1026127794 7:67594764-67594786 GAGGATCGCTAGAGTGCAGAAGG + Intergenic
1026521433 7:71121534-71121556 GAGGATTGCTTGAGTCCAGTAGG + Intergenic
1030031255 7:105371668-105371690 GAGGATCACTAGAGTCCAGGAGG + Intronic
1031595786 7:123648016-123648038 CAGGATTAGTAGAGAGCTCTTGG + Intergenic
1031832614 7:126646054-126646076 GATGATGACCAGAGTGCAGTGGG - Intronic
1033206578 7:139428331-139428353 GAGGATTACTTGAGTCCAGGAGG - Intergenic
1033227698 7:139574282-139574304 GAGGATTACTTGAGTCCAGGAGG + Intronic
1033475697 7:141690161-141690183 CAGGCTTACTAGAGTGGTGAGGG + Intronic
1035137772 7:156722635-156722657 CAGGATTAATGGAGTGCATTAGG - Intronic
1036976320 8:13417015-13417037 GAGGATTTCTTGAGAGCAGTCGG + Intronic
1040024902 8:42772625-42772647 GAGGATCACTTGAGTGCAGGAGG + Intronic
1040709375 8:50169906-50169928 CATCAAGACTAGAGTGCAGTGGG - Intronic
1041229295 8:55732638-55732660 GAGGATTACTTGAGTCCAGGAGG + Intronic
1042146482 8:65735396-65735418 CAGGATTACTTGAGCCCAGGAGG - Intronic
1044741325 8:95329557-95329579 CATGTTTAGGAGAGTGCAGTTGG - Intergenic
1045695167 8:104801091-104801113 CAGGATCACTGGAGTTCAGTGGG + Intronic
1047099557 8:121661708-121661730 GAGGATTACTTGAGTCCAGGAGG - Intergenic
1047976472 8:130135393-130135415 CAGGATCACTAGAGCCCAGGAGG + Intronic
1047984606 8:130219877-130219899 GAGGATTACTTGAGCCCAGTAGG - Intronic
1049993177 9:1009394-1009416 CACGCTTACTAAAGTGCAGTCGG + Intergenic
1051333605 9:16047000-16047022 CATGCTTACTAGAAAGCAGTAGG - Intronic
1052223408 9:26054973-26054995 CTGGATTACTAAAGTGTAGTTGG - Intergenic
1052758180 9:32563380-32563402 CAGGATGGCTGGAGTACAGTGGG + Intronic
1053624836 9:39858775-39858797 CAGGCTGACTAGATTGCACTAGG + Intergenic
1053880033 9:42584453-42584475 CAGGCTGACTAGATTGCACTAGG - Intergenic
1054219060 9:62391923-62391945 CAGGCTGACTAGATTGCACTAGG - Intergenic
1054231656 9:62517246-62517268 CAGGCTGACTAGATTGCACTAGG + Intergenic
1055977838 9:81971956-81971978 CAGGCTCACTAGAGGGCAGCAGG - Intergenic
1057593215 9:96391817-96391839 CTGGAGTACAAGAGTGCAGTGGG + Intronic
1058978891 9:110150809-110150831 CAGGAGTTCAAGAGTGCAGGCGG - Intronic
1059204790 9:112454415-112454437 GAGGATTACTTGAGTCCAGGAGG - Intronic
1061319595 9:129819880-129819902 CTGGAGTGCTGGAGTGCAGTGGG - Intronic
1186383242 X:9083337-9083359 GAGGATTACTTGAGTCCAGGAGG + Intronic
1187551353 X:20309041-20309063 CAGGATCACTTGAGCCCAGTAGG - Intergenic
1192427968 X:71094095-71094117 GAGGATTGCTTGAGTGCAGCAGG + Intergenic
1193127934 X:77889410-77889432 CAGGCTGGCTGGAGTGCAGTGGG + Intronic
1193395168 X:80975225-80975247 TAGGATTACTTGAGTTCAGGAGG + Intergenic
1193451733 X:81679274-81679296 GAGGATTTCTTGAGTGCAGGAGG - Intergenic
1196386123 X:115153232-115153254 GAGGATCACTGGAGTGCAGGAGG + Intronic
1196409047 X:115396607-115396629 GAGGATTACTTGAGTCCAGGAGG - Intergenic
1197272610 X:124442017-124442039 CAGTAATACCAGTGTGCAGTAGG - Intronic
1198172166 X:134117687-134117709 CAGGCCTCCTTGAGTGCAGTGGG - Intergenic
1200242394 X:154504288-154504310 CAGGATTACTTGAGCCCAGGAGG - Intergenic
1200750855 Y:6942891-6942913 TAGGATTGCTTGAGTCCAGTAGG + Intronic