ID: 904751179

View in Genome Browser
Species Human (GRCh38)
Location 1:32742087-32742109
Sequence CGGCGCAAGAAGAAGGCGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 93}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904751165_904751179 24 Left 904751165 1:32742040-32742062 CCGGCGCGTCCGGCCTCCGCCGC 0: 1
1: 0
2: 1
3: 35
4: 358
Right 904751179 1:32742087-32742109 CGGCGCAAGAAGAAGGCGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 93
904751169_904751179 8 Left 904751169 1:32742056-32742078 CCGCCGCGCCTTCAGCTGGCTGC 0: 1
1: 0
2: 0
3: 4
4: 176
Right 904751179 1:32742087-32742109 CGGCGCAAGAAGAAGGCGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 93
904751168_904751179 11 Left 904751168 1:32742053-32742075 CCTCCGCCGCGCCTTCAGCTGGC 0: 1
1: 0
2: 2
3: 17
4: 177
Right 904751179 1:32742087-32742109 CGGCGCAAGAAGAAGGCGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 93
904751166_904751179 15 Left 904751166 1:32742049-32742071 CCGGCCTCCGCCGCGCCTTCAGC 0: 1
1: 0
2: 5
3: 26
4: 376
Right 904751179 1:32742087-32742109 CGGCGCAAGAAGAAGGCGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 93
904751163_904751179 30 Left 904751163 1:32742034-32742056 CCCGCTCCGGCGCGTCCGGCCTC 0: 1
1: 0
2: 3
3: 9
4: 228
Right 904751179 1:32742087-32742109 CGGCGCAAGAAGAAGGCGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 93
904751171_904751179 5 Left 904751171 1:32742059-32742081 CCGCGCCTTCAGCTGGCTGCGGG 0: 1
1: 0
2: 0
3: 13
4: 152
Right 904751179 1:32742087-32742109 CGGCGCAAGAAGAAGGCGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 93
904751174_904751179 0 Left 904751174 1:32742064-32742086 CCTTCAGCTGGCTGCGGGGCAAG 0: 1
1: 0
2: 1
3: 18
4: 351
Right 904751179 1:32742087-32742109 CGGCGCAAGAAGAAGGCGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 93
904751164_904751179 29 Left 904751164 1:32742035-32742057 CCGCTCCGGCGCGTCCGGCCTCC 0: 1
1: 0
2: 2
3: 5
4: 135
Right 904751179 1:32742087-32742109 CGGCGCAAGAAGAAGGCGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904751179 Original CRISPR CGGCGCAAGAAGAAGGCGGC GGG Exonic
900339202 1:2179875-2179897 CTGCGCAAGGAGCCGGCGGCAGG + Intronic
902960615 1:19960685-19960707 AAGGGCAAGAAGAAGGCGGCAGG - Intergenic
904696788 1:32335722-32335744 CCGCGAACAAAGAAGGCGGCAGG + Intronic
904751179 1:32742087-32742109 CGGCGCAAGAAGAAGGCGGCGGG + Exonic
918002679 1:180512476-180512498 AAGGGCAAGAAGAAGGGGGCAGG + Intergenic
920389422 1:205589842-205589864 AGGCGCAAGAGGGAGGTGGCTGG + Intronic
921089649 1:211830647-211830669 CGGCGGAAGAAGGCGGTGGCGGG + Exonic
924539886 1:244970717-244970739 AGGAGAAAGAAGAAGGCGGGAGG - Exonic
1067814022 10:49457913-49457935 AGGCGCAAGACGAAGGCAACTGG + Exonic
1069705796 10:70458536-70458558 CGGAGCAAGAAGACCGAGGCTGG + Intergenic
1072190738 10:93074521-93074543 CAGCGCAAGAAGGTGGGGGCAGG + Exonic
1074165709 10:110872167-110872189 CGGGGCTACAAGAAGGCAGCCGG - Intronic
1074984326 10:118643569-118643591 CGGGGCAAGAGGGAGGCTGCTGG + Intergenic
1080283852 11:30586230-30586252 CGGCGCTAGAGGGAGGCGGGGGG + Intronic
1085120045 11:73961606-73961628 GGAGGCAGGAAGAAGGCGGCAGG - Intronic
1091549975 12:1530073-1530095 CGGCGCCGGGAGAAGGGGGCCGG + Intronic
1095998136 12:48106362-48106384 GGGCGGAACCAGAAGGCGGCGGG - Intronic
1097712897 12:62934760-62934782 CGGTGCGAGCAGGAGGCGGCGGG + Exonic
1104081909 12:125436529-125436551 CGTCGCATGAAGAAGGCAGAGGG + Intronic
1112124285 13:96447558-96447580 AAGGGCAAGAAGAAGGCAGCAGG - Intronic
1122997660 14:105274254-105274276 CTCAGCAAGAAGAATGCGGCAGG - Intronic
1124344521 15:28913384-28913406 CGGAGCTGGAACAAGGCGGCAGG - Intronic
1124913547 15:33946600-33946622 TGGCGCAAGAGGAAGCAGGCCGG + Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1129246892 15:74284807-74284829 AGGCGCAACAATAAGGGGGCAGG - Intronic
1129539925 15:76341108-76341130 CGGGGCAAGCAGAAGGCAGTAGG - Intronic
1132977083 16:2716268-2716290 CGGTGCAGGATGAGGGCGGCAGG - Intronic
1137476234 16:48811761-48811783 CGGGGCAAGAAGGATGGGGCTGG - Intergenic
1138105890 16:54286994-54287016 CGGCGCGAGCAGGAGGGGGCGGG - Intergenic
1143689125 17:8545916-8545938 CAGCACAAGGACAAGGCGGCAGG + Intronic
1143951069 17:10632570-10632592 CGGCTCAAGAAGAAGATGGAGGG - Exonic
1151291756 17:73155700-73155722 GGGAGCAAGAAGAAGCCAGCAGG + Intergenic
1157128034 18:44976198-44976220 TGGAGCAGGAAGCAGGCGGCAGG + Intronic
1157464182 18:47930498-47930520 CGGGGCGGGAAGACGGCGGCCGG - Exonic
1159947066 18:74451686-74451708 CGCCGCAAGAAGCAGGCGTCAGG - Intronic
1160988011 19:1848453-1848475 CGGAGCAAGATGGCGGCGGCGGG - Exonic
1161403946 19:4081627-4081649 AGGGGCAAGAAGGAGGCGGGAGG - Intergenic
1163029897 19:14537223-14537245 CGGGGCAAGAAGGAAGCGGCGGG + Intronic
1166069945 19:40381173-40381195 CGGGGCATGGAGAAGGGGGCAGG + Intronic
1167570107 19:50281609-50281631 CGGCGCCAGGAGGAGGAGGCAGG + Exonic
1168043781 19:53779506-53779528 AGGCTCTAGAAGAAGGCAGCTGG + Intergenic
1168100296 19:54137914-54137936 GGGCGCGAGAAAAAGGCGGCGGG + Intronic
927266537 2:21159190-21159212 GGGAGCAGGAAGAAGGCAGCAGG + Intergenic
930175042 2:48292966-48292988 AGGGGCAAAAAGAAGGAGGCTGG + Intergenic
932621832 2:73269341-73269363 CAGGGCAAGGAGCAGGCGGCCGG - Exonic
932812129 2:74834433-74834455 CGGCGCACAAAGAAGGCTACCGG - Exonic
934521872 2:95025055-95025077 CGGCCCCAGCAGAAGGCTGCTGG - Intergenic
942196571 2:173526656-173526678 CTGAGCAAAAAGAAGGAGGCTGG - Intergenic
946391308 2:219418416-219418438 GGGCGCACGGAGGAGGCGGCGGG - Exonic
946737898 2:222772960-222772982 GGACGCAGGGAGAAGGCGGCCGG + Intergenic
947536857 2:230945163-230945185 CTGCGCAAAAAGATGGCGGCGGG + Intronic
1172447393 20:35000369-35000391 CGGCTCAAGAAGAAGATGGAGGG + Exonic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1175905717 20:62378435-62378457 GGGCCCCAGAGGAAGGCGGCTGG - Intergenic
1176723775 21:10413728-10413750 CGGAGCAGTAAGATGGCGGCTGG + Intergenic
1179125073 21:38583265-38583287 TGGGGCAGGAAGAAGGAGGCAGG + Intronic
1180162713 21:46005514-46005536 CAGAGCAAGAAGAGGGCGGAGGG + Intergenic
1180216207 21:46324929-46324951 CGCGGGAAGAAGACGGCGGCCGG - Intronic
1180559425 22:16602681-16602703 GGGGGCGAGAAGAAAGCGGCCGG + Intergenic
1182143473 22:27982447-27982469 CGGCACAATAAGAAGGAGGAGGG - Exonic
1183361990 22:37387633-37387655 CAGCCCAGGAAGAAGGTGGCAGG - Intronic
954085502 3:48241066-48241088 CGGCGCCAGAAGAAAGAAGCAGG - Intergenic
955956289 3:64293318-64293340 AGACGAAAGACGAAGGCGGCTGG - Intronic
968075825 3:195815767-195815789 CTGTGTAAGAAGAAGGAGGCCGG - Intergenic
968075836 3:195815812-195815834 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075848 3:195815857-195815879 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075860 3:195815902-195815924 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075872 3:195815947-195815969 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075897 3:195816037-195816059 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075909 3:195816082-195816104 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075921 3:195816127-195816149 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075933 3:195816172-195816194 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075945 3:195816217-195816239 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076095 3:195816780-195816802 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076131 3:195816908-195816930 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076231 3:195817253-195817275 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
969596005 4:8149608-8149630 GGGGGCAGGCAGAAGGCGGCAGG + Intronic
992619123 5:78575123-78575145 CGTGGCAAGAAGGAGGCTGCAGG + Intronic
997976785 5:138445710-138445732 CGGCCCAAGAAGAAGACCTCTGG + Exonic
1002648476 5:180674048-180674070 GGGCGCGGGGAGAAGGCGGCGGG + Intergenic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1005848863 6:29803622-29803644 CGGGCCAAGAAGAAAGCTGCTGG - Intergenic
1006320702 6:33317716-33317738 CGGCGCAAGATGGCGGCGGGAGG - Exonic
1015181564 6:130366406-130366428 AGGCGGACGAAGAAGGCGGCAGG - Intronic
1015889513 6:137955486-137955508 CAGGGCAAGAAGAAGAGGGCGGG + Intergenic
1019270999 7:149205-149227 CGGCGCAATGAGGAGGCGGCCGG - Intergenic
1022923511 7:35038004-35038026 CGGGGCAGGGAGAAGGCGCCCGG + Exonic
1030820163 7:114084930-114084952 CGGCGCGCGGAAAAGGCGGCCGG + Intergenic
1032306218 7:130734122-130734144 CGGAGCGAGAAGCAGGAGGCCGG + Intergenic
1034427971 7:151024381-151024403 GGGGGGGAGAAGAAGGCGGCTGG - Exonic
1034617812 7:152435136-152435158 GGGGGCGAGAAGAAAGCGGCCGG - Intronic
1036163066 8:6406823-6406845 CGGGGGAGGAAGGAGGCGGCAGG - Intronic
1037789066 8:21920257-21920279 GGGCGTGAGAGGAAGGCGGCGGG - Intronic
1038798181 8:30727652-30727674 CGGCGCCAGCAGCGGGCGGCGGG + Exonic
1049828569 8:144685631-144685653 CGGGCCAAGAAGATGGCGGAGGG - Intergenic
1054456625 9:65434570-65434592 CCGGACAAGAGGAAGGCGGCAGG - Intergenic
1061839554 9:133349986-133350008 CGGGCCGAGAAGAAGGCTGCTGG + Exonic
1062022624 9:134326582-134326604 CGGCGCAGGCAGCGGGCGGCGGG - Exonic
1062059127 9:134485500-134485522 GGCCGCAAGAAGCAGGCAGCAGG - Intergenic
1062119778 9:134827994-134828016 CAGCTCAAGAAGAAGGCTGGGGG + Intronic
1189848567 X:45157908-45157930 AGGCGGGAGAAGAAGGGGGCGGG + Intronic
1200178659 X:154136848-154136870 CGGCGCCAGAAGAGGGCGCCCGG + Intergenic