ID: 904751703

View in Genome Browser
Species Human (GRCh38)
Location 1:32744672-32744694
Sequence ACTAGCAAGCCCCATGATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904751699_904751703 6 Left 904751699 1:32744643-32744665 CCAATGAGAGTTTAAATCCTGGC 0: 1
1: 1
2: 0
3: 24
4: 170
Right 904751703 1:32744672-32744694 ACTAGCAAGCCCCATGATGTAGG 0: 1
1: 0
2: 0
3: 6
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904751703 Original CRISPR ACTAGCAAGCCCCATGATGT AGG Intronic
900832025 1:4972358-4972380 ACTGGCAATTCCCATGATTTAGG - Intergenic
901859825 1:12067257-12067279 ACTGGCAAGGAACATGATGTTGG - Intronic
904695558 1:32328949-32328971 ACAAGCTAGGCCCATGATGTGGG - Intronic
904751703 1:32744672-32744694 ACTAGCAAGCCCCATGATGTAGG + Intronic
904882244 1:33709783-33709805 AACAGCCAGCCCCATAATGTAGG + Intronic
905749305 1:40448554-40448576 ACTTGTAAGCCACATGATCTTGG + Intergenic
912503828 1:110141961-110141983 ACCACCATGCCCCATGATGAAGG - Intergenic
912805653 1:112755039-112755061 CCTAGAAAGTCCCATTATGTGGG - Intergenic
912904661 1:113691483-113691505 AGAAGCAAGCACCATGATTTAGG + Intergenic
915863087 1:159468583-159468605 ACCAGCTAGCTGCATGATGTAGG - Intergenic
918997592 1:191782049-191782071 TCTAGCAAGCCCCATCATGATGG - Intergenic
1063764378 10:9121363-9121385 ATTTGCAAGCTCCATGATTTGGG + Intergenic
1064391436 10:14945798-14945820 ACAAGCACGCGCCATGATGCCGG + Intronic
1064836496 10:19537408-19537430 ACTTGCCAGCCCCTTGATCTTGG - Intronic
1065720823 10:28627325-28627347 ACGAGCAAGCTGAATGATGTGGG - Intergenic
1069714561 10:70512407-70512429 ACCAGAAAGCCACATGCTGTAGG + Intronic
1072197996 10:93133170-93133192 TCTAACAACCCCCATGAAGTAGG - Intergenic
1072690483 10:97569659-97569681 ACCAGCCAGCACCATGATGCCGG - Intronic
1073189255 10:101639100-101639122 ATTAGCAAGCTGCATGATTTGGG - Intronic
1074107091 10:110396479-110396501 AATAGCAACACCCATCATGTTGG - Intergenic
1088430840 11:109757147-109757169 TCCAGCAATCACCATGATGTGGG + Intergenic
1100229425 12:92592430-92592452 AGTAACATGCCCCATCATGTTGG - Intergenic
1108462609 13:50682169-50682191 ACTAACTACCCCCATGGTGTGGG - Intronic
1109657325 13:65410309-65410331 TATAGTAAGCCCCATGAAGTTGG - Intergenic
1111961321 13:94813884-94813906 ATTAGCACGGCCCATGGTGTTGG - Intergenic
1114290945 14:21287995-21288017 ACTGGCAAGTCTCCTGATGTAGG - Exonic
1114528794 14:23382368-23382390 ATTAGCATGCCCCCTGATATGGG - Intronic
1118983724 14:70735578-70735600 AGTAGGAAGCCCCAGGCTGTGGG - Intronic
1119978334 14:79051089-79051111 ACTAGCAAACTGCATTATGTGGG - Intronic
1120318039 14:82921257-82921279 ATTAGAAACCCCCATGATTTAGG - Intergenic
1123006308 14:105325401-105325423 CCAAGCAAGGCCCAGGATGTTGG - Intronic
1123125341 14:105941890-105941912 ATTCCCAAGCCCCACGATGTGGG - Intergenic
1126352306 15:47757060-47757082 ACTAGCAAGCACCAAGCTGCTGG - Intronic
1128565026 15:68695380-68695402 TCCAGCAAGCCCCACGATGTGGG + Intronic
1131895316 15:97021851-97021873 ACTAGCCAGCACCTTGATCTTGG + Intergenic
1135106901 16:19657705-19657727 AATAGCCAGGGCCATGATGTGGG + Intronic
1139327342 16:66162740-66162762 ACTTGCAAGGCTCATCATGTCGG + Intergenic
1142525822 17:540030-540052 TCTAGCAAGCACCTTGTTGTGGG - Intronic
1143418890 17:6773641-6773663 TCTAGAAAACCCCATGATCTTGG + Exonic
1151596174 17:75079173-75079195 CCTTGCCAGCCCCGTGATGTGGG - Intergenic
1162041759 19:7975122-7975144 ACTTGCTCACCCCATGATGTGGG + Intronic
1163509881 19:17728035-17728057 ACCAGCAAGCCCCTTGGTTTTGG - Exonic
1168207854 19:54865451-54865473 ACTTGCTAACCCCATCATGTGGG + Intronic
925712288 2:6753076-6753098 ACCAGCCAGCACCATGATCTTGG + Intergenic
927856733 2:26532442-26532464 GCCAGCAAGCCCCATGCTGGGGG + Intronic
932266721 2:70374012-70374034 AATAGCAAACCCCATGCTATGGG + Intergenic
933437485 2:82266654-82266676 ACTAGCAAGCTCTTTGTTGTAGG + Intergenic
936593279 2:113823785-113823807 AATAGCAATACCAATGATGTGGG + Intergenic
1169014724 20:2282368-2282390 AATAGCAAGCCCCAACATGAGGG + Intergenic
1171142309 20:22753875-22753897 ACTTGCAAGCTCCCTGCTGTTGG - Intergenic
1173555827 20:43964902-43964924 ACTTGGAGGCTCCATGATGTAGG - Intronic
1173676038 20:44836420-44836442 ACCACCAAGCCCCATGTTGCTGG - Intergenic
1174300884 20:49581344-49581366 ACTTGCAAGCTCCACAATGTTGG - Intergenic
1174912020 20:54617804-54617826 ACTAGCAAGTGCCATAAAGTAGG - Intronic
1184838458 22:47038143-47038165 AATAGCAGGCACCATTATGTGGG + Intronic
955403318 3:58609088-58609110 ACAAGGAGGCCCCATGATGCAGG + Intronic
961524024 3:127485129-127485151 ACTTACAAGCCCCATGTTGACGG + Intergenic
968766050 4:2469674-2469696 ACTCGCAGGCCCCACGATGGCGG - Intronic
969478239 4:7433265-7433287 GCTAGCGAGGCCCATGAGGTGGG - Exonic
979913636 4:126403966-126403988 ACTGGAAGGCCTCATGATGTGGG + Intergenic
985063515 4:186100904-186100926 ACCAGCCAGCCCCATGAAGAAGG - Intergenic
985209338 4:187575406-187575428 GCTAGGAAGCCCCATGATCTGGG - Intergenic
986754711 5:10824339-10824361 AACAGCAAGCCAGATGATGTGGG - Intergenic
987673227 5:21041469-21041491 TCTAGAAAACCCCATAATGTTGG + Intergenic
990628493 5:57641266-57641288 ACTAGGAAGTAGCATGATGTGGG - Intergenic
994013683 5:94939437-94939459 ACTAGCAAGCGTACTGATGTGGG + Intronic
995262872 5:110125813-110125835 TCTAGAAAGCCCCATCATCTTGG - Intergenic
995394338 5:111671318-111671340 ACTCTGAAGCCCCATGCTGTGGG + Intronic
1001430877 5:171660944-171660966 ACCATCAAGCCCCATGAAGTAGG + Intergenic
1001709732 5:173768579-173768601 ACTTGCTAGCCATATGATGTGGG + Intergenic
1004989506 6:21121299-21121321 ACTTGCAAGCTAGATGATGTCGG + Intronic
1011813055 6:91155228-91155250 ACTGGGAAGCCCCAGGATGATGG - Intergenic
1014160528 6:118162752-118162774 ACTAGCAAGTTCCTTGATGCAGG - Intronic
1014481561 6:121945143-121945165 TCTAGCAAGCCACATGTTATTGG + Intergenic
1015368373 6:132423582-132423604 ACAAGCAAGCATCATGATGATGG - Intergenic
1019574494 7:1729925-1729947 ACCAGCAGGCCCCAGGAGGTGGG + Intronic
1021187205 7:17577789-17577811 ACCAGCAAGCATCATGATGACGG + Intergenic
1023672542 7:42593100-42593122 TCTAGCTAGCCCCATGAGGGTGG + Intergenic
1031909553 7:127501011-127501033 TCTAGAAAACCCCATAATGTTGG + Intergenic
1033444424 7:141407957-141407979 ACATGCCAACCCCATGATGTAGG + Intronic
1034016930 7:147597561-147597583 ACTAACAAGCCCCATTACCTGGG + Intronic
1037612067 8:20484224-20484246 ACTAGATAGCCCCATGATCCTGG + Intergenic
1039110302 8:34034584-34034606 ACCAGCAAGTCCCATGATTGTGG + Intergenic
1041834084 8:62192122-62192144 ACTTGCCAGCCCCTTGATCTTGG + Intergenic
1042193206 8:66208877-66208899 ACTAGCAACCCCCTTCCTGTAGG - Intergenic
1046702927 8:117420760-117420782 ACTAGCTAGCATCATGATGACGG + Intergenic
1047568279 8:126070510-126070532 ACTTGCAAGCCTCATGACCTTGG - Intergenic
1048804705 8:138229233-138229255 TCTAGCAGGCCCCATGAAGAAGG - Intronic
1049014902 8:139913403-139913425 GCTTGCTAGCTCCATGATGTTGG - Intronic
1050026967 9:1345168-1345190 ACAGGAAAGCTCCATGATGTTGG - Intergenic
1051537214 9:18173354-18173376 CATAGGAGGCCCCATGATGTTGG - Intergenic
1053089724 9:35263889-35263911 GCTAGCCAGCCCCTTGATCTTGG + Intronic
1055505734 9:76946808-76946830 TCTACCAAGCCTCATAATGTAGG - Intergenic
1056063314 9:82907265-82907287 ACTAGCAATCCCAATGAATTAGG - Intergenic
1056498637 9:87186258-87186280 ACTATCTTGCCCCATGATGGGGG - Intergenic
1056846130 9:90039726-90039748 ACAAGCAGGCCTCATGGTGTGGG - Intergenic
1059963665 9:119592251-119592273 ATTTTAAAGCCCCATGATGTTGG + Intergenic
1060338685 9:122752592-122752614 ACTAGCAGGGACCTTGATGTCGG - Intergenic
1186487990 X:9948638-9948660 ACTGGCAAGCTCAATGATGCAGG + Exonic
1187205947 X:17181423-17181445 AGTAGCAAGCCCCATTATGCAGG - Intergenic
1190413058 X:50156146-50156168 ACTAGCTATCCCTATGGTGTCGG + Intergenic
1192045302 X:67665670-67665692 ACTAGCAAGCCCTTTTATGATGG + Intronic
1194245546 X:91507292-91507314 ACTAGCAAGCCACATGTAGAAGG + Intergenic
1200564515 Y:4748542-4748564 ACTAGCAAGCCACATGTAGAAGG + Intergenic