ID: 904752819

View in Genome Browser
Species Human (GRCh38)
Location 1:32751573-32751595
Sequence GTGATCAGTACTATATCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 86}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904752819 Original CRISPR GTGATCAGTACTATATCAGA AGG Intronic
904752819 1:32751573-32751595 GTGATCAGTACTATATCAGAAGG + Intronic
905565292 1:38959672-38959694 GTGATCAGTCCAGTATCTGATGG - Intergenic
907868661 1:58423341-58423363 GTGATCAGCTCTATGCCAGAGGG - Intronic
908331659 1:63076862-63076884 GTGATCAGTACACTAACGGAGGG + Intergenic
909767583 1:79376400-79376422 GTGATAAATACTATTTCACATGG - Intergenic
910538539 1:88328145-88328167 CTGATAATTACCATATCAGAAGG - Intergenic
911546555 1:99224646-99224668 GTGCTCAGTGCTTTATGAGAGGG + Intergenic
916423122 1:164654911-164654933 GTGATCTGTATTATCACAGAGGG + Intronic
919337668 1:196259751-196259773 CAAAACAGTACTATATCAGAGGG + Intronic
922518695 1:226227191-226227213 GTAATCAATATTATATCAGCAGG + Intergenic
1065274344 10:24070136-24070158 GTGATCAGAAGTATAAAAGAGGG + Intronic
1069662117 10:70130749-70130771 GTGTTCAGTTCAAAATCAGATGG - Intronic
1073629724 10:105136338-105136360 GGGATCAGTGCTTTATAAGAGGG - Intronic
1083500035 11:63096849-63096871 GAGATAAGTAATATATCAAATGG - Intronic
1083506477 11:63162159-63162181 GTGATTAGTCCTTTGTCAGAGGG + Intronic
1090424519 11:126597860-126597882 TTGATCAGTACTGTATCATTTGG + Intronic
1090661609 11:128886280-128886302 GTGATCGGCGCTCTATCAGAGGG + Intergenic
1092121191 12:6045032-6045054 GAGATGTGTAGTATATCAGATGG - Intronic
1096423011 12:51476525-51476547 CTTCTCAGTTCTATATCAGAAGG - Intronic
1101051783 12:100871484-100871506 GTGCTCAGTGCTATAACAGAAGG - Intronic
1102882807 12:116498742-116498764 TTTATAAGTACAATATCAGAGGG - Intergenic
1106451054 13:29882804-29882826 GTGCTCACTACCATATCTGATGG - Intergenic
1107109247 13:36677832-36677854 GTGACCAGGATTATATCAGAGGG + Intronic
1107975261 13:45682163-45682185 GTGAAAAGGACTAGATCAGAGGG + Intergenic
1120381022 14:83779959-83779981 ATGATTAGTACTATCTCAAATGG - Intergenic
1120657931 14:87217848-87217870 GTGATCTGTGCTATTTCTGATGG + Intergenic
1122320885 14:100855104-100855126 GTGCTCAGTGCTATAGTAGAGGG - Intergenic
1129195970 15:73966818-73966840 CAGATCAGTACCATATCAGAAGG + Intergenic
1134335453 16:13295383-13295405 GTGTTCAGTACTTTTCCAGAAGG - Intergenic
1135115649 16:19721071-19721093 GTGATGAGTATTATAACAGATGG + Intronic
1139076530 16:63456947-63456969 GTTAGCAGTAATATATCATATGG - Intergenic
1145850375 17:28088241-28088263 GTGATCTGTACTTAATCAGGAGG + Intronic
1150067695 17:62125329-62125351 GTGATCGGTGCTGTAACAGAAGG - Intergenic
1151526605 17:74673857-74673879 GTTGTCAGCACTATATAAGAAGG - Intronic
1157338891 18:46761304-46761326 GTTATCAGTAATTTAGCAGATGG - Intergenic
1158195990 18:54885606-54885628 GTGATGAGTACTATTTTAGATGG - Intronic
1158196067 18:54886168-54886190 GTGATGAGTACTATTTCAGATGG - Intronic
1159488836 18:69102817-69102839 GACATCAGTAGTAGATCAGAGGG + Intergenic
1163226189 19:15963074-15963096 GTGGTCAGGACAATCTCAGAGGG + Intergenic
1164218970 19:23176273-23176295 GTCATCTGTACAATATCAGATGG + Intergenic
926787947 2:16536984-16537006 GTGATCACTACTATCTGATATGG - Intergenic
929643426 2:43604238-43604260 GTTATCATTACTATATGAAATGG - Intergenic
932862489 2:75308955-75308977 GTGAGCAGTAATATTTCAAAAGG - Intergenic
936340508 2:111627710-111627732 ATAATTAGAACTATATCAGAGGG - Intergenic
936563104 2:113559141-113559163 ATATTCAGTTCTATATCAGAAGG + Intergenic
939111788 2:138017287-138017309 GTGCTCAGTACTATGTGAAATGG + Intergenic
941366799 2:164620268-164620290 GTGATTAGTAAAATATCATAAGG - Intronic
945601461 2:211871038-211871060 GTGATTAGTGCTATATTTGAAGG + Intronic
1170434885 20:16316017-16316039 GTGGTTTCTACTATATCAGAGGG - Intronic
1179645699 21:42774548-42774570 GTGTTCAGCAATATATCTGATGG + Intronic
1183076647 22:35431586-35431608 TTGATGAGTCCTATATCAGGAGG - Intergenic
1184384820 22:44167991-44168013 GTGATCAGGACTAAAGCACAGGG + Intronic
949649566 3:6140616-6140638 GTGAGAAGTACTTTATCAAATGG + Intergenic
960306289 3:116065458-116065480 GTGATCTGTACTGTACTAGAGGG + Intronic
961095161 3:124148212-124148234 GTTTTTAGTACTAGATCAGATGG + Intronic
964680015 3:159328207-159328229 GTAATGACTACTATATTAGATGG + Intronic
965677629 3:171214586-171214608 GTGGTCATTAGTTTATCAGAGGG - Intronic
967553075 3:190822841-190822863 CTGCTTAGTACCATATCAGATGG - Intergenic
968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG + Intergenic
970893084 4:21069814-21069836 GTGTTAAGTACTATGTAAGATGG - Intronic
975337237 4:73193259-73193281 GTGAACAGTACTTCATCATATGG + Intronic
975673868 4:76807710-76807732 GTGAACAGTACCTTCTCAGATGG - Intergenic
977431734 4:96938839-96938861 GTGTTGAATACTTTATCAGATGG + Intergenic
981264130 4:142760979-142761001 GTGATGTGTACTATATTAGTGGG - Intronic
983869166 4:172804820-172804842 GTGAACTGTACAAGATCAGATGG + Intronic
987628568 5:20436013-20436035 GTGCTCAGTTCTAGATCATATGG - Intronic
993508228 5:88737634-88737656 GTGAACAGGAATTTATCAGATGG + Intronic
993532096 5:89037479-89037501 GTCATCAGTAAGATATCAGAGGG - Intergenic
993811142 5:92477708-92477730 GCGATCAGTGCTACCTCAGAAGG - Intergenic
998522890 5:142816802-142816824 GTGATCAGTCCTTGAGCAGAGGG + Intronic
999062520 5:148651812-148651834 TTGATCAGTTAAATATCAGAAGG + Intronic
999939519 5:156526546-156526568 GTGATTTGTACTAAGTCAGAAGG + Intronic
1006709799 6:36058402-36058424 GTAGTCAGTAGTTTATCAGAAGG - Intronic
1011873197 6:91923117-91923139 GTTATTAATACTACATCAGATGG - Intergenic
1012313290 6:97755131-97755153 GTGTTCAGTGCTAGATCACATGG - Intergenic
1013699410 6:112746110-112746132 GTAAGTAGTCCTATATCAGATGG - Intergenic
1016086088 6:139916666-139916688 GTGATCTGTATTATCTTAGATGG + Intergenic
1016457595 6:144247065-144247087 GTGATCAGAATTGTGTCAGAGGG + Intergenic
1016654768 6:146505782-146505804 CTGAACAGTGCTATAGCAGAGGG + Intergenic
1018169290 6:161131733-161131755 GTGATCGATACTATGTCAGTTGG + Exonic
1022191021 7:28016951-28016973 GTTATGTGTACTATGTCAGATGG + Intronic
1023732307 7:43203791-43203813 GTCATCAGTAACATATCAAAAGG + Intronic
1026549346 7:71354195-71354217 CAGACCCGTACTATATCAGATGG + Intronic
1030591051 7:111482388-111482410 GTGTTCAGTTCTATAGTAGAAGG - Intronic
1031662278 7:124440375-124440397 ATGATCATGATTATATCAGAGGG + Intergenic
1043807582 8:84691651-84691673 GTGGTGAGGCCTATATCAGATGG + Intronic
1046882219 8:119321502-119321524 TTGATCAGCACTCTATCACATGG + Intergenic
1049889628 9:56546-56568 ATATTCAGTTCTATATCAGAAGG - Intergenic
1053731111 9:41057821-41057843 ATATTCAGTTCTATATCAGAAGG - Intergenic
1054697402 9:68374268-68374290 ATATTCAGTTCTATATCAGAAGG + Intronic
1058199185 9:102017653-102017675 CTGATCATTGCTATATCACAAGG + Intergenic
1060378990 9:123147554-123147576 GTGATCCCTACTATTTGAGAAGG + Intronic
1188779277 X:34260444-34260466 GTGATAAGTGCTTTATGAGAAGG + Intergenic
1190938887 X:55021093-55021115 GTAATCATTACTACACCAGACGG + Exonic
1199534346 X:148885317-148885339 GAGATCGGTCATATATCAGAAGG + Intronic