ID: 904753246

View in Genome Browser
Species Human (GRCh38)
Location 1:32754104-32754126
Sequence CGCTGGGGGCCTTCCTCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 122}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904753246_904753263 16 Left 904753246 1:32754104-32754126 CCACAAGAGGAAGGCCCCCAGCG 0: 1
1: 0
2: 0
3: 14
4: 122
Right 904753263 1:32754143-32754165 CTTCTGGCGGTTCGGGCGGTCGG 0: 1
1: 0
2: 0
3: 4
4: 42
904753246_904753265 28 Left 904753246 1:32754104-32754126 CCACAAGAGGAAGGCCCCCAGCG 0: 1
1: 0
2: 0
3: 14
4: 122
Right 904753265 1:32754155-32754177 CGGGCGGTCGGCGAAGCGGCCGG 0: 1
1: 0
2: 0
3: 12
4: 118
904753246_904753264 24 Left 904753246 1:32754104-32754126 CCACAAGAGGAAGGCCCCCAGCG 0: 1
1: 0
2: 0
3: 14
4: 122
Right 904753264 1:32754151-32754173 GGTTCGGGCGGTCGGCGAAGCGG 0: 1
1: 0
2: 0
3: 1
4: 31
904753246_904753259 8 Left 904753246 1:32754104-32754126 CCACAAGAGGAAGGCCCCCAGCG 0: 1
1: 0
2: 0
3: 14
4: 122
Right 904753259 1:32754135-32754157 GTCCGCAGCTTCTGGCGGTTCGG 0: 1
1: 0
2: 1
3: 7
4: 44
904753246_904753257 3 Left 904753246 1:32754104-32754126 CCACAAGAGGAAGGCCCCCAGCG 0: 1
1: 0
2: 0
3: 14
4: 122
Right 904753257 1:32754130-32754152 CCCGGGTCCGCAGCTTCTGGCGG 0: 1
1: 0
2: 1
3: 11
4: 140
904753246_904753260 9 Left 904753246 1:32754104-32754126 CCACAAGAGGAAGGCCCCCAGCG 0: 1
1: 0
2: 0
3: 14
4: 122
Right 904753260 1:32754136-32754158 TCCGCAGCTTCTGGCGGTTCGGG 0: 1
1: 0
2: 1
3: 30
4: 65
904753246_904753262 12 Left 904753246 1:32754104-32754126 CCACAAGAGGAAGGCCCCCAGCG 0: 1
1: 0
2: 0
3: 14
4: 122
Right 904753262 1:32754139-32754161 GCAGCTTCTGGCGGTTCGGGCGG 0: 1
1: 0
2: 1
3: 5
4: 116
904753246_904753254 0 Left 904753246 1:32754104-32754126 CCACAAGAGGAAGGCCCCCAGCG 0: 1
1: 0
2: 0
3: 14
4: 122
Right 904753254 1:32754127-32754149 GTCCCCGGGTCCGCAGCTTCTGG 0: 1
1: 0
2: 0
3: 9
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904753246 Original CRISPR CGCTGGGGGCCTTCCTCTTG TGG (reversed) Intronic
900395936 1:2453265-2453287 CCCTGGGGCCCTTCCCCGTGTGG + Intronic
900686147 1:3948949-3948971 GGCTGGGGACCTTCCTGTGGGGG - Intergenic
903070108 1:20722861-20722883 TGCTGGGGGCCTTCCTGCTGTGG - Exonic
904420455 1:30387566-30387588 CGCTGGTGGCTTTCCACTTGAGG + Intergenic
904753246 1:32754104-32754126 CGCTGGGGGCCTTCCTCTTGTGG - Intronic
910803598 1:91168274-91168296 CCCTGAGGGCCTTCCTCTATAGG + Intergenic
915612637 1:157006836-157006858 CACTGGGGCCCTTCATCTTCTGG - Intronic
917460477 1:175224924-175224946 CTATAGGGGCCTTCTTCTTGGGG + Intergenic
920867143 1:209762604-209762626 GGCTGGGGGCCTTCCTCCACAGG + Exonic
922798379 1:228352822-228352844 GGCTGGGGCCCTTCCCCTTGTGG + Intronic
1065655111 10:27940637-27940659 AGCTGGGGGCATTCCTCTGTTGG - Exonic
1070730715 10:78826309-78826331 AGGTGGGGTCCTTCCTCATGAGG + Intergenic
1076817664 10:132922774-132922796 CACTGCAGGCCTTCCTCTGGAGG - Intronic
1077128219 11:954172-954194 CGTTGGTGGCTTTCCTTTTGAGG + Intronic
1077268496 11:1664288-1664310 CTCTGGGGGCCTTCCATCTGTGG - Intergenic
1077272383 11:1687330-1687352 CTCTGGGGGCCTTCCATCTGTGG + Intergenic
1083282879 11:61638359-61638381 GGCTGGGGGCCTGCTTCATGTGG - Intergenic
1083291125 11:61690791-61690813 CAAAGGGGGCCTTCCTTTTGTGG - Intronic
1083314908 11:61808668-61808690 TGCTTGGGGGCTTCCTATTGTGG - Intronic
1083436375 11:62646364-62646386 CGCTGGGGGCCTTGCCTGTGGGG - Intronic
1084118716 11:67056721-67056743 GGCTGGGGCCCTTCCTCTCCAGG - Intergenic
1084789310 11:71463477-71463499 GGCAGGGGGCCTACCTGTTGAGG - Exonic
1091297132 11:134481942-134481964 CCCTGGGGCCCTGCCTCTTCAGG + Intergenic
1096575839 12:52552375-52552397 AGATGTGGTCCTTCCTCTTGAGG - Intronic
1113797299 13:113065956-113065978 CTCGTGGGGCCTTGCTCTTGAGG - Intronic
1115852977 14:37602093-37602115 CGTTGGGGCCCCTGCTCTTGGGG + Intronic
1117602748 14:57391257-57391279 CGCTCAGGACCTTGCTCTTGAGG - Exonic
1119415349 14:74465974-74465996 TGCTGCTGGCCTTCCTCTTGTGG - Intergenic
1119771785 14:77224676-77224698 CGGTTGAGGCCTTTCTCTTGGGG - Intronic
1119806438 14:77485308-77485330 CCCTGGGGGCCTTTCTCCTCTGG - Intronic
1120950242 14:90034342-90034364 CCCTGGGGACCTCCCTTTTGAGG - Intronic
1121033802 14:90682572-90682594 CTGTTGGGGCCTTCCTTTTGTGG + Intronic
1121368197 14:93333254-93333276 CGCTGGGAGTTTGCCTCTTGTGG + Exonic
1121767880 14:96502833-96502855 GGCCGGGGGCCTTCCCCTTCCGG + Intronic
1122211212 14:100175281-100175303 TGCTGGGAGCCTCCCTCTTGGGG + Intergenic
1122871161 14:104639687-104639709 GGGTGGGGTCCTTCCTCCTGGGG + Intergenic
1132891333 16:2206244-2206266 CGCTGGGGGGATGCCTCGTGTGG + Intronic
1136711187 16:32238527-32238549 CACGGAGGGCCCTCCTCTTGTGG - Intergenic
1136756720 16:32690880-32690902 CACGGAGGGCCCTCCTCTTGTGG + Intergenic
1136811390 16:33179495-33179517 CACGGAGGGCCCTCCTCTTGTGG - Intergenic
1136817866 16:33289575-33289597 CACGGAGGGCCCTCCTCTTGTGG - Intronic
1136824430 16:33346104-33346126 CACGGAGGGCCCTCCTCTTGTGG - Intergenic
1136829496 16:33444875-33444897 CACGGAGGGCCCTCCTCTTGTGG - Intergenic
1137054001 16:35734838-35734860 CGCCTGGGGCCTTCCTGTGGGGG + Intergenic
1137674748 16:50298779-50298801 GGCTGGGGGCTTGCCTCCTGGGG - Intronic
1138240614 16:55424419-55424441 GGCTGGTGGTCTTCCCCTTGGGG - Intronic
1142232269 16:88905541-88905563 CTCTGGGGGCCTTCCTTTGAAGG - Intronic
1202989968 16_KI270728v1_random:2464-2486 CACGGAGGGCCCTCCTCTTGTGG - Intergenic
1203058869 16_KI270728v1_random:951232-951254 CACGGAGGGCCCTCCTCTTGTGG + Intergenic
1146079099 17:29761235-29761257 CGAGGGGCGCCTTCCTCTTGCGG + Intronic
1148038789 17:44689738-44689760 CGCTGGGCGCCGCCATCTTGGGG + Exonic
1148865572 17:50626484-50626506 CCTTGGGGGCCAGCCTCTTGGGG + Exonic
1148953577 17:51335460-51335482 CGCTGGTCTCCTCCCTCTTGGGG - Intergenic
1149772510 17:59332305-59332327 CCCTGGGGGCCTTCCACTGTGGG + Intronic
1151809859 17:76432667-76432689 CGCAGGTGGGCTACCTCTTGTGG - Intronic
1152063770 17:78098562-78098584 CGATGGGGGCCTTACCCTTTAGG + Intronic
1152610991 17:81314941-81314963 AGCTGGGAGCCCTCCGCTTGAGG - Intronic
1155237609 18:23836689-23836711 CCCTGGGGCCCTTTCTCTCGAGG + Intronic
1158260470 18:55600690-55600712 CTCTGGTGGCATTCCTCTTTGGG + Intronic
1160658554 19:287641-287663 TGCTGGGGACCTTCCTGTTTGGG - Exonic
1163366666 19:16879422-16879444 GGCTGGGGTCCCTCCCCTTGTGG - Exonic
1165420295 19:35718842-35718864 TGGTGGAGGGCTTCCTCTTGGGG + Intronic
1166944930 19:46390692-46390714 CTCTGGGGGTCTTCCTATGGCGG - Exonic
1167708381 19:51095272-51095294 GGCTTGCGGCCTTCCTCATGGGG - Intergenic
925015179 2:518553-518575 TGCTGGTGGCTTTCCACTTGGGG - Intergenic
928308508 2:30191048-30191070 CACTTGGGGCCCTCCTCTTTCGG + Intergenic
928336720 2:30404708-30404730 CGCTGGGGGTCGTCCACTTCAGG + Intergenic
929494173 2:42425047-42425069 CGCTGCGGGCCTGCTTCCTGGGG + Intronic
931184561 2:59937572-59937594 GGCTGGGGGCCTTCCTGTCTAGG - Intergenic
934913560 2:98279830-98279852 CCCTGGGGGCCAGCCTCTGGGGG + Intronic
936376508 2:111945837-111945859 CCCTGGGGGCTTCCCTCTGGGGG + Intronic
936600623 2:113890626-113890648 CGCTGGGGACGGTCGTCTTGGGG + Intronic
942768171 2:179482317-179482339 CTTTAGGGGCCTCCCTCTTGTGG - Intronic
945544677 2:211136702-211136724 TACTGGGGTCCTTCCTCTAGGGG - Intergenic
1169231111 20:3889429-3889451 CGCTGGGGGGCTTGCTCGGGCGG + Exonic
1169771693 20:9208161-9208183 CCCTGGGACCCTTCCTCTTAAGG - Intronic
1171229930 20:23476019-23476041 CTCAGGGGCCCTTCCTCCTGCGG + Intergenic
1172167393 20:32907543-32907565 TGCTGGGGGCCCTCCTTTAGGGG + Intronic
1172210617 20:33195568-33195590 CCCTGGGGAACTTCCTCTTTGGG + Intergenic
1172785633 20:37466528-37466550 CCCTCAGGGCCATCCTCTTGAGG + Intergenic
1174171072 20:48618607-48618629 CCCAGGGGGCTTCCCTCTTGGGG - Intergenic
1175518336 20:59583536-59583558 CGCGGGGAGCCTCCCTCCTGGGG - Intronic
1175766835 20:61598134-61598156 CGCCGGGGACTTGCCTCTTGGGG + Intronic
1175993987 20:62804377-62804399 CTCTGGGGGGATTTCTCTTGGGG + Intergenic
1176021355 20:62963892-62963914 CGCTCGGTGCCTTCCTGCTGCGG + Intronic
1178158238 21:29880006-29880028 CCCTGGGGGCCTTCATATTATGG + Intronic
1178414467 21:32392880-32392902 CGCCCGAGGCCTTCCTCTTGGGG + Exonic
1180260738 21:46667310-46667332 CGCTGGCCGCCTTCCGCGTGAGG - Intergenic
1181919737 22:26311372-26311394 CGCTGGGGGACTTTCTGTTCTGG + Intronic
1183468924 22:37995401-37995423 TGCTGGGAGACTTCCTCCTGGGG + Intronic
1183746878 22:39697244-39697266 CCCTGGGGGCCTCACTCATGAGG + Intergenic
1184333768 22:43841483-43841505 CCCTGGGGGCCCTCCTCTGAGGG - Intronic
1184388448 22:44189297-44189319 CGCTGGGGTCCTTCTGCTTCAGG + Intronic
1184638938 22:45858631-45858653 TGCTGGGGTCCTTCCTCAAGGGG + Intergenic
1184744802 22:46450067-46450089 CGGTGGGGGCCTTGCTGGTGTGG - Intronic
1185171361 22:49296439-49296461 GGCATGTGGCCTTCCTCTTGGGG - Intergenic
1185302557 22:50090108-50090130 AGCTGGTGGCCTTCTTCTGGAGG + Exonic
950501673 3:13367871-13367893 ATCTGGGTGCCTTCCTCTTGGGG + Intronic
953567487 3:44045148-44045170 CGGTGGGGGCCTGGCCCTTGGGG - Intergenic
955631570 3:60980986-60981008 TGCTGAGGGCCTCCCTCTTGAGG + Intronic
959127108 3:102302952-102302974 CGCAGGAGGCCATCTTCTTGAGG - Intronic
965000502 3:162946899-162946921 ACCTGGGGGTCTTCCTCATGTGG - Intergenic
968454838 4:692239-692261 CGCTGGGTGCCTTTGTCTGGAGG - Intergenic
968486824 4:866960-866982 GGCAGGGGGCCCTCCTCTTGGGG + Exonic
969077305 4:4590247-4590269 CGCTGAGGGCCTCCTTCTTGGGG - Intergenic
969933562 4:10658465-10658487 AGCTGGGGGGTTTCCTCTAGGGG + Intronic
980704497 4:136475184-136475206 CCCTGGGGGGCTGCCTCTGGTGG - Intergenic
981348269 4:143700014-143700036 GGCAGGGGGCCGTCCTCGTGAGG + Exonic
985975929 5:3419112-3419134 CGCTGGGGTCCTCGCTCTTATGG - Intergenic
987069233 5:14320453-14320475 TGCTGAGGGGCTTCCTCTAGGGG - Intronic
991043004 5:62194787-62194809 GGCAGATGGCCTTCCTCTTGTGG + Intergenic
999264401 5:150256941-150256963 CCCTGGGGCCCCTCCTTTTGTGG - Intronic
1000302936 5:159972261-159972283 CGCCGGGCGCCTTCCACTCGGGG - Exonic
1002123428 5:177023067-177023089 CGCTGGGGGCCCGATTCTTGGGG - Intronic
1005054244 6:21715046-21715068 ACCTGAGTGCCTTCCTCTTGAGG + Intergenic
1018792284 6:167157706-167157728 CGCTGTGGACCTTCCTGTTCCGG - Exonic
1019847437 7:3520143-3520165 CTCTGGAGCCCTTCCTCTGGGGG + Intronic
1022497659 7:30863116-30863138 CGCCGAGGGCCTTCCTGTTCTGG + Intronic
1024204267 7:47142532-47142554 CGCTGAGGGCTTTGCTCCTGTGG - Intergenic
1024325688 7:48107573-48107595 CGCTGGGGCCCCTCCTCCTGGGG + Intronic
1024343904 7:48293233-48293255 TGCTGGGGGGCTCCATCTTGGGG + Intronic
1024865389 7:53899990-53900012 CACTTGGGGACTTCCTCTTTTGG + Intergenic
1026384035 7:69827860-69827882 TGCTGTGGGCCTTCCTCTGTGGG - Intronic
1037805551 8:22056363-22056385 CTCTGGGGCCCAGCCTCTTGAGG - Intronic
1044733693 8:95255325-95255347 AGCTGGGGGTGTTCCTCTGGTGG - Intronic
1052483900 9:29070514-29070536 CGATGGTAGCCTTCTTCTTGAGG - Intergenic
1057519982 9:95752464-95752486 CGCTGAGGGCCCTCCTTTTGAGG - Intergenic
1059344201 9:113617025-113617047 CCCTGGGGCCCTTCACCTTGTGG - Intergenic
1060103200 9:120857635-120857657 CGCTGGGACCCTTCCTCCTGAGG - Exonic
1060552631 9:124492802-124492824 CCCTGGGAGCCCTGCTCTTGGGG - Intronic
1061071577 9:128314031-128314053 AGCTGGTGCCCTTCCTCCTGGGG - Intronic
1061325421 9:129861070-129861092 GGCTGGGGGCCCTCATCTGGAGG + Intronic
1062574386 9:137199688-137199710 CCCCGGAGGCCTTGCTCTTGGGG + Exonic
1192448001 X:71224698-71224720 CTCCCGGGGCCTTCCTTTTGAGG + Exonic
1195731268 X:107970226-107970248 TGCTGGAGTCCTGCCTCTTGTGG + Intergenic
1196944087 X:120806906-120806928 AGCTGAATGCCTTCCTCTTGAGG - Intergenic
1199347713 X:146761288-146761310 GTCTGCAGGCCTTCCTCTTGGGG - Intergenic