ID: 904753625

View in Genome Browser
Species Human (GRCh38)
Location 1:32755853-32755875
Sequence CTCTCCTAGAATCTGCACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 146}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904753620_904753625 5 Left 904753620 1:32755825-32755847 CCTGAAAGCCCTGTCTGTGCCTA 0: 1
1: 0
2: 2
3: 26
4: 222
Right 904753625 1:32755853-32755875 CTCTCCTAGAATCTGCACTAAGG 0: 1
1: 0
2: 0
3: 12
4: 146
904753622_904753625 -4 Left 904753622 1:32755834-32755856 CCTGTCTGTGCCTACCTGTCTCT 0: 1
1: 0
2: 2
3: 52
4: 460
Right 904753625 1:32755853-32755875 CTCTCCTAGAATCTGCACTAAGG 0: 1
1: 0
2: 0
3: 12
4: 146
904753621_904753625 -3 Left 904753621 1:32755833-32755855 CCCTGTCTGTGCCTACCTGTCTC 0: 1
1: 0
2: 4
3: 51
4: 465
Right 904753625 1:32755853-32755875 CTCTCCTAGAATCTGCACTAAGG 0: 1
1: 0
2: 0
3: 12
4: 146
904753617_904753625 15 Left 904753617 1:32755815-32755837 CCCCAGCAGTCCTGAAAGCCCTG 0: 1
1: 0
2: 5
3: 28
4: 600
Right 904753625 1:32755853-32755875 CTCTCCTAGAATCTGCACTAAGG 0: 1
1: 0
2: 0
3: 12
4: 146
904753615_904753625 20 Left 904753615 1:32755810-32755832 CCCTGCCCCAGCAGTCCTGAAAG 0: 1
1: 1
2: 2
3: 30
4: 271
Right 904753625 1:32755853-32755875 CTCTCCTAGAATCTGCACTAAGG 0: 1
1: 0
2: 0
3: 12
4: 146
904753618_904753625 14 Left 904753618 1:32755816-32755838 CCCAGCAGTCCTGAAAGCCCTGT 0: 1
1: 0
2: 2
3: 17
4: 176
Right 904753625 1:32755853-32755875 CTCTCCTAGAATCTGCACTAAGG 0: 1
1: 0
2: 0
3: 12
4: 146
904753614_904753625 30 Left 904753614 1:32755800-32755822 CCAGCACTCTCCCTGCCCCAGCA 0: 1
1: 2
2: 12
3: 110
4: 823
Right 904753625 1:32755853-32755875 CTCTCCTAGAATCTGCACTAAGG 0: 1
1: 0
2: 0
3: 12
4: 146
904753619_904753625 13 Left 904753619 1:32755817-32755839 CCAGCAGTCCTGAAAGCCCTGTC 0: 1
1: 0
2: 2
3: 19
4: 182
Right 904753625 1:32755853-32755875 CTCTCCTAGAATCTGCACTAAGG 0: 1
1: 0
2: 0
3: 12
4: 146
904753616_904753625 19 Left 904753616 1:32755811-32755833 CCTGCCCCAGCAGTCCTGAAAGC 0: 1
1: 0
2: 3
3: 21
4: 265
Right 904753625 1:32755853-32755875 CTCTCCTAGAATCTGCACTAAGG 0: 1
1: 0
2: 0
3: 12
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904753625 Original CRISPR CTCTCCTAGAATCTGCACTA AGG Intronic
902094874 1:13934880-13934902 CTCTCATTGAACCTGCACTGGGG - Intergenic
902989226 1:20174485-20174507 CTCTCCTAGAATATGGAATTAGG + Intronic
904753625 1:32755853-32755875 CTCTCCTAGAATCTGCACTAAGG + Intronic
911723508 1:101217169-101217191 ATCTGCTAGAATTTGCACTCTGG + Intergenic
911802207 1:102156259-102156281 CCCTCCTAGCACCTCCACTATGG + Intergenic
913086139 1:115438903-115438925 CTGTCCTTGAATTTCCACTAAGG - Intergenic
915305041 1:154972396-154972418 CTCTTCTGGAATGAGCACTAAGG - Intronic
915608375 1:156969906-156969928 CTTTCCTGGAATCTGCCCCATGG + Intronic
916307479 1:163354486-163354508 CTCTGCTAGAATTTAAACTAAGG + Intronic
916457288 1:164983839-164983861 CTCTCCCAGAAGATGCACAAGGG - Intergenic
918238328 1:182600801-182600823 CTCTCCTGGGATTTGCACCAAGG + Intronic
919794818 1:201315184-201315206 CTCACCTAGAACCTCCACTCAGG - Intronic
921954724 1:220970283-220970305 CTCTCCTAGCTTCTGGACCACGG + Intergenic
1064090636 10:12380269-12380291 CTCTGCTAGATTCAGAACTAAGG - Intronic
1065327555 10:24562597-24562619 CTCTCCTGGAATCTAGACTGGGG + Intergenic
1067454231 10:46404779-46404801 CTCTCCGAGAATTTCCACAAAGG - Intergenic
1067632972 10:47979853-47979875 CTCTCCGAGAATTTCCACAAAGG + Intergenic
1070736729 10:78868094-78868116 CTCTTCCAGAATCTCCTCTAGGG + Intergenic
1072642114 10:97219648-97219670 CTATCCTAGAATCGGGATTAGGG - Intronic
1074090690 10:110250882-110250904 CTCTCCTGCAGTCAGCACTAAGG - Intronic
1075747329 10:124736836-124736858 CCCTCCTAGAAGCTGCAGCATGG + Intronic
1079007494 11:16802290-16802312 GTCTCCTAGGATCTGGGCTATGG - Intronic
1079376243 11:19894657-19894679 CTCTACTGGAATTTGCACCATGG - Intronic
1080306691 11:30844357-30844379 CTCACAGAGAATCTGTACTAGGG - Intronic
1080805124 11:35646065-35646087 CTCTCCTAGAGTCTCCAAAAAGG - Intergenic
1086966571 11:93034030-93034052 CTTTCCTAGGATGTGCTCTAGGG + Intergenic
1088812605 11:113401674-113401696 CTCTCCTGGAAGCTGAACTAGGG - Intergenic
1091809212 12:3380907-3380929 TTCTCCTAGGACCTGGACTAAGG + Intergenic
1094169142 12:27473264-27473286 CTCTCCTGGAGGCTGCATTAGGG - Intronic
1095070580 12:37839245-37839267 TTCTCCTAGAATCTGCAAAGGGG + Intergenic
1095096271 12:38151040-38151062 CTCTCCTACAACCAACACTACGG + Intergenic
1097059147 12:56269531-56269553 CTATCCTCGAACCTGCACTGTGG + Exonic
1098076839 12:66740443-66740465 TTCTCCTAGAATCTGAACTGTGG + Intronic
1099265210 12:80437792-80437814 CTCTCCTAGAATCTCCAAAAAGG - Intronic
1102948555 12:117011661-117011683 CTCTCCTAGGATCTCCACACAGG + Intronic
1105818499 13:24058553-24058575 CTCTGCTAGAATCTCCAATCAGG - Intronic
1107085823 13:36427205-36427227 CTTTCCCAGATTCTGCACCAAGG - Intergenic
1108498762 13:51049768-51049790 CTCTCCTAGGATCTGCATGGTGG - Intergenic
1110419862 13:75294548-75294570 TACTCCTAAAATCTGGACTAGGG - Intronic
1110819696 13:79900238-79900260 CTCTCCTAGAACCTTCAGAAAGG + Intergenic
1111649849 13:91075681-91075703 CTCTACTAGAAGCTCAACTAGGG - Intergenic
1117080060 14:52142646-52142668 CTCTGCTAGCATCTGAACTCAGG + Intergenic
1118661363 14:68016705-68016727 CACTCCTAGAATCTGTGCTAAGG + Intronic
1123185964 14:106517311-106517333 TGCTCCTAGAATCAGGACTAAGG + Intergenic
1126431876 15:48594451-48594473 CTATCCTGAAATCTGCACTAAGG - Intronic
1127993015 15:64134570-64134592 CTCTCCCAGCAGCTGCACCAGGG - Intronic
1128752362 15:70158648-70158670 CTCCCCAAGATTCTGCTCTAGGG + Intergenic
1132850490 16:2022891-2022913 CTGTCCTGGAATCTGCAGTCTGG - Intergenic
1133845449 16:9449140-9449162 CTCTCCTGGAATCTACATTTGGG - Intergenic
1136577139 16:31131583-31131605 CTGTCCTCGAAGCTGCACAAAGG + Exonic
1141222778 16:82086924-82086946 CTCTCCTTGAACATGCACCAAGG - Intronic
1141452032 16:84110809-84110831 CTTTCCTAAAATCTCCCCTAGGG + Intronic
1141508548 16:84497164-84497186 CTCTTCTAGAATGTGCAGCATGG - Intronic
1141717121 16:85733339-85733361 GTCTCTAAGAATCTGCTCTAGGG - Intronic
1142162328 16:88564513-88564535 CTCTCCTAGCAGGTGCTCTAAGG + Intergenic
1144777876 17:17793870-17793892 CTCGCCAAGTATCAGCACTACGG + Exonic
1145287717 17:21518912-21518934 CTCTCCTAGAGTCTGGATTGGGG - Intergenic
1146012164 17:29204823-29204845 CACACCTATAATCTGCACTTTGG - Intergenic
1153321768 18:3780394-3780416 CTCCCCTAGAACCTGCAGAAAGG - Intronic
1154237823 18:12622855-12622877 CTCTTTCAGAATCTTCACTATGG + Intronic
1156047866 18:32897629-32897651 CCCTCCAAGAATCTGAACTAGGG + Intergenic
1156081676 18:33343159-33343181 CTTTCCCATAATCTACACTATGG - Intronic
1156259068 18:35427787-35427809 CTCTCCTAGAACCTCCAAAAAGG + Intergenic
1156700352 18:39817599-39817621 CTATCATAAAATCTGCAGTAAGG + Intergenic
1158594407 18:58803679-58803701 ATCTCCTAGAAGCTGCTCTTTGG + Intergenic
1159200601 18:65178976-65178998 CTCTCCTAGACTCTGTAGGAGGG + Intergenic
1163141677 19:15353580-15353602 TTCACCTGGAATCTCCACTAAGG + Exonic
1165652850 19:37506509-37506531 CTCTCCTAGGAGCTCCCCTATGG - Intergenic
927094594 2:19738044-19738066 CTCTCTTAGCATCTGCACAATGG - Intergenic
942489584 2:176476140-176476162 CTCTACTAGCATCTGAACTATGG + Intergenic
944290569 2:197999711-197999733 CCTTTCCAGAATCTGCACTAAGG - Intronic
948497501 2:238361640-238361662 CTCTCCTTGTTTCAGCACTATGG + Intronic
1169921241 20:10736266-10736288 CTTTCATAAAATGTGCACTAGGG - Intergenic
1174517457 20:51103530-51103552 CTCTCCCAGATTCTGAAATAGGG - Intergenic
1174554300 20:51382851-51382873 CTCTCCTAAAATCTGCCCTGTGG - Intergenic
1175460807 20:59150730-59150752 CTCTCCTTGAGTCTGCCCAACGG + Intergenic
1177447666 21:21218702-21218724 CTCTCCTAGAACCTTCAGAAAGG + Intronic
1178740292 21:35193766-35193788 CTCAGCTAGAACCTGCACTTCGG + Intronic
1179770733 21:43613862-43613884 GTCTCCCAGAAGCTGCAATATGG + Exonic
1181614389 22:24042789-24042811 CTCTCCTTGAATATGCACCCCGG - Intronic
1183287946 22:36979575-36979597 CTCTCCTAACCTCAGCACTAAGG + Intergenic
949571506 3:5297981-5298003 CTCTCCTATAATACACACTAGGG - Intergenic
950465560 3:13151304-13151326 CTCTGCTACAACATGCACTAGGG - Intergenic
952919538 3:38275372-38275394 CTCTGCCAGAATCTGCACGTTGG + Exonic
953674987 3:44994004-44994026 CTCTCCTTGAATCTGTAATTTGG - Intronic
956089859 3:65654725-65654747 CTCACCCAGAAGCTGCAGTATGG + Intronic
956426747 3:69144251-69144273 CTCTCATAGAATCTACATCATGG + Intergenic
956560064 3:70565332-70565354 CTCCCCTCAAATCTGAACTAGGG - Intergenic
956743931 3:72296586-72296608 CTCTCCTAGTAACTCCATTAGGG - Intergenic
957652906 3:83032391-83032413 CTGTCCTAGTTTCTGCCCTATGG + Intergenic
958635256 3:96736242-96736264 CTCTCCTGGAAGCAACACTAAGG - Intergenic
960455613 3:117867438-117867460 CTGTCCTAGAATTTGGCCTAGGG + Intergenic
961943419 3:130660412-130660434 ATCTCCTAGGATCAGCACTCTGG + Intronic
963764583 3:149321217-149321239 ATTTCCAAGAATCTGTACTAGGG - Exonic
964534475 3:157704536-157704558 TTCTCATAGAATGTGCAATAGGG - Intergenic
964778066 3:160301970-160301992 CACTTCTAGAAGCTGTACTAAGG - Intronic
967123226 3:186402345-186402367 CTCACCTAGAGTCCACACTAAGG + Intergenic
967715261 3:192755283-192755305 CTTTAATAGAATCTGCACCATGG - Intronic
967785266 3:193486581-193486603 TTCTCCTCAAATCTGCACTTAGG - Intronic
971937070 4:33164647-33164669 CTCTTCTAGTAACTGCACCAGGG + Intergenic
973693068 4:53460070-53460092 GCCTCCTAGAAACTACACTATGG - Intronic
977394232 4:96451217-96451239 CTTTCCTAGAATATGTACTGAGG + Intergenic
977627506 4:99203312-99203334 TTCTCCTAGAATTAGGACTAAGG - Exonic
977667244 4:99655203-99655225 CTCTCCTAGAATCCTTACTGTGG + Intergenic
979043206 4:115826902-115826924 CTCTCTTAGAATCTCCATGAAGG - Intergenic
988317035 5:29644136-29644158 CTCTCCTCAAAGCTCCACTAGGG - Intergenic
990054066 5:51547900-51547922 CTTTCCTAGAATCTTCAATGGGG - Intergenic
993815146 5:92534373-92534395 GTCTCCTACTATCTGCACTTTGG - Intergenic
993936662 5:94013012-94013034 CTCTCCCAGAATTTGCACATGGG - Intronic
994775313 5:104031624-104031646 CTCCCCTAGATTCTGCCATAGGG + Intergenic
996667613 5:126078803-126078825 CTCTTCTAGTATATGTACTAAGG - Intergenic
997925238 5:138024420-138024442 CTCCCCTAGAATCTGCCCTGTGG + Intronic
998435600 5:142105641-142105663 CTCTTCAAGAATCTGCAGAATGG + Intergenic
998747951 5:145283103-145283125 CGCCCCTAGAATCAGCATTAAGG + Intergenic
1002831618 6:826980-827002 TACTCCTAGAAACTTCACTAAGG - Intergenic
1003041178 6:2688553-2688575 GTCTCCTGGAGGCTGCACTATGG + Intronic
1004448343 6:15723356-15723378 CTATCCTAGTGTCTGCACTCTGG + Intergenic
1005273518 6:24191642-24191664 TTTTCCTAGAATCCGCAATAGGG - Intronic
1007560424 6:42803506-42803528 CTTTCCAAGAATATGCACCAAGG - Intronic
1008004169 6:46392487-46392509 CTGTCCTAGATACTGCAGTAAGG + Intronic
1010568450 6:77448031-77448053 AGCACCTAGACTCTGCACTAAGG + Intergenic
1011151608 6:84280141-84280163 CTTCCCAAGAATCTGCCCTATGG - Intergenic
1014795167 6:125716617-125716639 CTCTCCTAGAATTTACAGTCTGG - Intergenic
1015688690 6:135895920-135895942 CTCTCCTGAAATCTGCCCCAAGG + Intronic
1015821514 6:137266205-137266227 CTCTCCTAGAAACTCCTCTGAGG - Intergenic
1016776639 6:147911625-147911647 ATCTCCTAGAATGTGCAAAAGGG - Intergenic
1020804550 7:12772530-12772552 CTCTCCTGGGATCTGGACTGGGG - Intergenic
1020976457 7:15012946-15012968 CTCTCCTACAATCTGTTCTCAGG + Intergenic
1023732075 7:43201680-43201702 TTCTCCTAGACTCTAGACTAGGG + Intronic
1024036525 7:45511483-45511505 CTCTCATAGAATCTTCCCTATGG + Intergenic
1028331281 7:89595940-89595962 CTTTCTTACAATCTGCACTTTGG - Intergenic
1030381511 7:108816619-108816641 CTCTCCTAGAATCAGGGCTCAGG + Intergenic
1032459322 7:132098064-132098086 CGGTCCTTGAATCTGAACTAAGG - Intergenic
1032614577 7:133453295-133453317 ATCTCCCAGAATTTTCACTATGG - Intronic
1036002118 8:4618029-4618051 ATCACTTAGAATATGCACTATGG + Intronic
1037550042 8:19961795-19961817 ATCTCTTAGCATCTGCATTAAGG - Intronic
1037746184 8:21646785-21646807 CTATCCTAGAATCTCCCCCACGG - Intergenic
1038247240 8:25870283-25870305 CTCTACGAAAATCTGCACTTTGG - Intronic
1041084280 8:54242805-54242827 CTCTCCTAGAATTTCCACGCAGG + Intergenic
1042642434 8:70951172-70951194 CTCTTCTAGAAGCTGTCCTATGG - Intergenic
1045714360 8:105024492-105024514 CACTCATGGAATCTGCAATATGG - Intronic
1045762750 8:105629628-105629650 CTCTCCTAGAACCTCCAGAAAGG - Intronic
1047404161 8:124571178-124571200 CTCTCCTGGAATCTGCCTCAGGG + Intronic
1047613038 8:126539648-126539670 CTATCCTATACTCTGAACTACGG + Intergenic
1050950417 9:11584314-11584336 CTCTCTAAGACTCTGCTCTAGGG - Intergenic
1052634147 9:31079107-31079129 ATATCTTAGAATCAGCACTAAGG + Intergenic
1054843928 9:69772432-69772454 GACTCCTAGAAACTTCACTAAGG + Intergenic
1058155364 9:101508765-101508787 CTCCCGTAGATTCTGCATTATGG - Intronic
1059107798 9:111526235-111526257 CTCTCCTAGCCTTTGCACCAAGG - Intronic
1060248072 9:121963141-121963163 CTCACGTAGGATCTGCAGTAGGG - Intronic
1187148189 X:16656775-16656797 CTCTCCAAGATTCTGCTATACGG + Intronic
1188910338 X:35839638-35839660 CTCTTCCAGTATCTGCCCTAAGG - Intergenic
1189067749 X:37829037-37829059 CTCTCCTAGAAGCTCCAGAAAGG + Intronic
1189826023 X:44918584-44918606 TTCTCCTAGAATTTTCACTATGG - Intronic
1192429775 X:71103907-71103929 TTCTCCCAATATCTGCACTAAGG - Intronic
1193596834 X:83456945-83456967 CTTTCCAAGTATTTGCACTAAGG - Intergenic
1196969624 X:121094837-121094859 CTCCCCTAGAACCTCCATTAAGG - Intergenic
1199246929 X:145616088-145616110 ATCTCCTAGAGTCTCCATTAGGG + Intergenic
1199683686 X:150245155-150245177 CTCTCCTAGAGTGTTCCCTAGGG + Intergenic