ID: 904757131

View in Genome Browser
Species Human (GRCh38)
Location 1:32774123-32774145
Sequence GCTTCCCCATTGGCCCCTGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 197}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904757127_904757131 -3 Left 904757127 1:32774103-32774125 CCACCTGTCTAGGCAAGCTGGCT 0: 1
1: 0
2: 1
3: 13
4: 195
Right 904757131 1:32774123-32774145 GCTTCCCCATTGGCCCCTGTGGG 0: 1
1: 0
2: 1
3: 13
4: 197
904757125_904757131 3 Left 904757125 1:32774097-32774119 CCTGTGCCACCTGTCTAGGCAAG 0: 1
1: 0
2: 0
3: 13
4: 112
Right 904757131 1:32774123-32774145 GCTTCCCCATTGGCCCCTGTGGG 0: 1
1: 0
2: 1
3: 13
4: 197
904757128_904757131 -6 Left 904757128 1:32774106-32774128 CCTGTCTAGGCAAGCTGGCTTCC 0: 1
1: 0
2: 1
3: 6
4: 138
Right 904757131 1:32774123-32774145 GCTTCCCCATTGGCCCCTGTGGG 0: 1
1: 0
2: 1
3: 13
4: 197
904757123_904757131 18 Left 904757123 1:32774082-32774104 CCTTTCTATTTTCAGCCTGTGCC 0: 1
1: 0
2: 1
3: 26
4: 272
Right 904757131 1:32774123-32774145 GCTTCCCCATTGGCCCCTGTGGG 0: 1
1: 0
2: 1
3: 13
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904757131 Original CRISPR GCTTCCCCATTGGCCCCTGT GGG Exonic
900361538 1:2291481-2291503 GCCTGGCCATTGGCCCCTGGTGG + Intronic
900487724 1:2931352-2931374 GCTTCCCCATGAGTCCCAGTGGG - Intergenic
901220034 1:7578468-7578490 CCTTCCCCAGTGGCATCTGTGGG - Intronic
902198607 1:14817016-14817038 GCTTGGCCAATGGCCACTGTTGG - Intronic
902392447 1:16114559-16114581 GGTTCTCCATGGGCCCCTCTCGG + Intergenic
903031138 1:20465206-20465228 GCAGCCCCCTTGGCCTCTGTGGG + Intergenic
904757131 1:32774123-32774145 GCTTCCCCATTGGCCCCTGTGGG + Exonic
904909908 1:33927061-33927083 GCTTCTCCTTTGGGGCCTGTTGG - Intronic
905168945 1:36098779-36098801 GGCTCCCCTTTGGCCCCTGATGG + Exonic
906323952 1:44832745-44832767 GCCTCCCTATTGGCCCCTATTGG - Intronic
909204147 1:72731657-72731679 GCATTCCCAGTGGCTCCTGTGGG + Intergenic
911674518 1:100644211-100644233 CCTTTTCCATTGGCCACTGTAGG - Intergenic
919424863 1:197417450-197417472 TCTTCCCAATAGGCCTCTGTTGG + Intronic
919859748 1:201731681-201731703 GCTTCTGTCTTGGCCCCTGTGGG + Intronic
920265822 1:204721868-204721890 GCTTTCCAACTGGCCCCTCTAGG + Intergenic
920299328 1:204978789-204978811 GTTTTCCCTTGGGCCCCTGTGGG + Intronic
923262111 1:232277283-232277305 ACTTCCCCAGTGGGACCTGTTGG - Intergenic
924552917 1:245095060-245095082 GATGCCCCCTTGGCTCCTGTTGG - Intronic
924583224 1:245339896-245339918 TCTTCCCCATTGGGCCGTGTTGG + Intronic
924797298 1:247301420-247301442 GCTACACCAGTGGCCCCTGCAGG - Intronic
1063713026 10:8499194-8499216 ACTTCCCCAGTAGCTCCTGTAGG + Intergenic
1066791125 10:39064953-39064975 TTATCCCCATAGGCCCCTGTGGG + Intergenic
1069831978 10:71287199-71287221 GCTGCCCCCTTGGGCCCTATGGG + Intronic
1070143842 10:73759644-73759666 GGGTCCCCATTGGCCCCTGTGGG + Exonic
1070427513 10:76304033-76304055 CCTTCCCCTTTGGTCCCTGGAGG + Intronic
1073494588 10:103879724-103879746 GCTTCCGCCCTGGCCCCTCTTGG - Intergenic
1076112602 10:127872451-127872473 ACTTCCACAAGGGCCCCTGTGGG + Intergenic
1076574092 10:131452563-131452585 GCTCCCCCACTGAGCCCTGTAGG + Intergenic
1077581084 11:3417806-3417828 GTTGCCCCATGGGCCCCTGTTGG - Intergenic
1078047088 11:7924747-7924769 GCTTTCCACTTGGCCTCTGTAGG + Intergenic
1079409352 11:20172791-20172813 GGTTCCCAATTGGTCCCTGATGG + Intergenic
1079673661 11:23199111-23199133 GGCTCTACATTGGCCCCTGTTGG + Intergenic
1081553207 11:44133070-44133092 GCTTGCCAATTGTCCCCTTTGGG + Intronic
1081848766 11:46260408-46260430 GCCTCCCCACCTGCCCCTGTGGG - Intergenic
1081887216 11:46508118-46508140 GCTTCCAAGTTGGCCACTGTTGG - Intronic
1084238012 11:67800644-67800666 GTTGCCCCACGGGCCCCTGTTGG - Intergenic
1084296725 11:68216877-68216899 GCTTTCCCAGTGGCCCCTCTGGG + Intergenic
1084562280 11:69911695-69911717 GCCTCCCCATTGGCCTCCCTGGG - Intergenic
1084672785 11:70616841-70616863 TCTTCCTCAGCGGCCCCTGTCGG - Intronic
1084834397 11:71792190-71792212 GTTGCCCCACGGGCCCCTGTTGG + Intronic
1084892065 11:72241510-72241532 GCTTTCCCCTTGGCCGCTCTTGG - Intronic
1085499567 11:77007405-77007427 GGTTCCTCTTTGGCCTCTGTTGG + Intronic
1087628638 11:100624638-100624660 TCTTCCCCATTATCACCTGTGGG + Intergenic
1089365141 11:117916990-117917012 GCTGCCCCCGGGGCCCCTGTGGG - Intronic
1089567391 11:119378897-119378919 GCCACCCCATTGGGCCCGGTGGG - Intronic
1091654217 12:2333503-2333525 CCTTCCCCTTAGGCCACTGTGGG - Intronic
1091771026 12:3151482-3151504 CCTTCACATTTGGCCCCTGTCGG + Intronic
1091843571 12:3637723-3637745 CCTTCCCCATTGGCCGGGGTCGG - Intronic
1092124518 12:6065946-6065968 GGTTCCCCATTGGCCCTGGCTGG - Intronic
1092408684 12:8238274-8238296 GTTGCCCCACGGGCCCCTGTTGG - Intergenic
1094579916 12:31725088-31725110 CCTTACCCATTCGCCACTGTGGG - Intronic
1096551077 12:52371997-52372019 GCTTGCCCATTGCCTCCTGCAGG + Intergenic
1100798291 12:98205011-98205033 TCTTCCCCATTTTCTCCTGTGGG - Intergenic
1100980228 12:100157533-100157555 GCTTCTCCATGGCCCCCTGCAGG + Intergenic
1101452054 12:104788907-104788929 GCTTCCCCATGTGACCCTGCAGG - Intergenic
1103767359 12:123290168-123290190 GCTTCCCCATGGGCGCCAGAGGG + Exonic
1105405728 13:20131202-20131224 ACTTCCCCAGTGGCGCCTGTGGG - Intergenic
1105501242 13:20974788-20974810 GCTTCCCTATTGGCCTGTGAGGG + Exonic
1105514274 13:21076207-21076229 GCTTCCCCATAGGCCAGTGCTGG + Intergenic
1112008515 13:95274651-95274673 GCTTCCCCATGTGGCCCTGCAGG + Intronic
1113060100 13:106313751-106313773 GCTTCCCTGTGGGCCTCTGTTGG + Intergenic
1113437980 13:110307679-110307701 GCCTCCCGTTAGGCCCCTGTGGG - Intronic
1113894971 13:113758856-113758878 GCCTCCCCATTGGCCGGTGACGG - Intergenic
1115978620 14:39024121-39024143 GCTTCCCCATCTGCCCCTTTTGG - Intergenic
1118545004 14:66876281-66876303 TCTTTCCCATTTTCCCCTGTGGG - Intronic
1118685178 14:68283715-68283737 GCTGCCCCACTGGCCCCAATGGG - Intronic
1121954817 14:98204352-98204374 CCTTCCACTCTGGCCCCTGTAGG - Intergenic
1122907971 14:104811051-104811073 GCTCCACCATTGCTCCCTGTGGG - Intergenic
1124651441 15:31477057-31477079 GTATCCCCATTGGCCACTGGTGG - Exonic
1125743902 15:41986275-41986297 GCTGTCCCATTGGCCCCAGATGG + Intronic
1126194189 15:45913253-45913275 GCTTCCCCAGTGCCCCCACTAGG - Intergenic
1127487671 15:59434605-59434627 TCTTCCTCATTGCTCCCTGTGGG + Intronic
1129296659 15:74603681-74603703 GCTCACCCATTGGCCTCTGGTGG + Intronic
1129789074 15:78328715-78328737 GCTTCCCCCTTGGGCCATGGAGG - Intergenic
1130276169 15:82477399-82477421 GCTTCTCCATGGCCCCCTGCAGG + Intergenic
1130468528 15:84204792-84204814 GCTTCTCCATGGCCCCCTGCAGG + Intergenic
1130485224 15:84394970-84394992 GCTTCTCCATGGCCCCCTGCAGG - Intergenic
1130495736 15:84468750-84468772 GCTTCTCCATGGCCCCCTGCAGG - Intergenic
1130590821 15:85209391-85209413 GCTTCTCCATGGCCCCCTGCAGG + Intergenic
1132383874 15:101386285-101386307 GCCTCCCCAGTGGCACCTGCTGG + Intronic
1132736479 16:1388462-1388484 GCTTCCTCTCTGGTCCCTGTTGG - Intronic
1133349645 16:5093091-5093113 GTTGCCCCACAGGCCCCTGTTGG - Intronic
1134237893 16:12482001-12482023 AATTCACCAGTGGCCCCTGTTGG - Intronic
1135660492 16:24292322-24292344 GCTTCCCCAAGGGCCTCTTTAGG + Intronic
1137626889 16:49914733-49914755 GCCTCACCCATGGCCCCTGTTGG - Intergenic
1139394979 16:66631993-66632015 GCTCAGCCAGTGGCCCCTGTGGG + Intronic
1141322051 16:83020383-83020405 GCCTCCCCACTGCCCTCTGTGGG + Intronic
1141807135 16:86349230-86349252 GTTTCCCCAAGGGCCCCTCTGGG - Intergenic
1142668282 17:1474893-1474915 GCCTCCCCGCAGGCCCCTGTGGG + Intronic
1144740813 17:17581174-17581196 ACTTCCCCACTGGGCCCTGGGGG + Intronic
1145942453 17:28749742-28749764 GCTTCAGCCCTGGCCCCTGTGGG + Exonic
1152093150 17:78257893-78257915 GCTTCCTCCCTGGCCTCTGTGGG + Intergenic
1152333066 17:79684808-79684830 GCTGCCCCAGTGGGCCCAGTGGG + Intergenic
1152590309 17:81208456-81208478 GCTGCCTCAATGGCCCCAGTGGG - Intronic
1155323860 18:24646651-24646673 GTTTCCACACTGTCCCCTGTTGG - Intergenic
1155727078 18:29100032-29100054 GCTTAGCCATTTGCCTCTGTTGG - Intergenic
1157293260 18:46424864-46424886 CCTTCCTCACTGGCCTCTGTGGG + Intronic
1157314899 18:46579150-46579172 GTTCCCACATTGGCCCCTGGGGG + Intronic
1159225521 18:65529444-65529466 ACTTTCCCATTGGCCACAGTAGG - Intergenic
1160897177 19:1408264-1408286 GCGTCCCCGTTGCCGCCTGTAGG + Intronic
1161104585 19:2437029-2437051 GCCTCCCCTCTGGCTCCTGTGGG + Intronic
1164333062 19:24279371-24279393 TTTTCACCATAGGCCCCTGTGGG + Intergenic
1164506683 19:28866927-28866949 ATTTCTCCACTGGCCCCTGTAGG + Intergenic
1165466229 19:35976726-35976748 GCTGCCCCTTTGGCCTGTGTGGG + Intergenic
1165559709 19:36668320-36668342 ACTCCCGCAGTGGCCCCTGTGGG + Intergenic
1166749986 19:45160007-45160029 GCTTCCTCACAGGCCTCTGTCGG + Intronic
1167711062 19:51111340-51111362 GTTTCCCCATTCTCCTCTGTGGG + Intergenic
1168482884 19:56736371-56736393 GCTTCCCCTGCGGCCCCTCTTGG + Intergenic
929036315 2:37695341-37695363 GCTTCCCCACTGGCTTCTGATGG - Intronic
930989025 2:57628331-57628353 GCTCTTCCAGTGGCCCCTGTGGG - Intergenic
932042028 2:68309857-68309879 GCTTTTTCAATGGCCCCTGTAGG - Intronic
932056372 2:68447945-68447967 GCCTGCCCATTGGCCCAGGTGGG + Intergenic
932401654 2:71484909-71484931 GTCCTCCCATTGGCCCCTGTGGG + Intronic
933274611 2:80270194-80270216 GCTTCCTGCTTAGCCCCTGTGGG + Intronic
936467277 2:112764667-112764689 GCGTCCTCATTGGCTCCTGCGGG + Exonic
937822059 2:126321733-126321755 GCTTCCCCACTTGCTCCTGGTGG - Intergenic
937997921 2:127709009-127709031 GCTTACCCTTTGGCCTCTGGCGG - Intronic
938395534 2:130945027-130945049 GATCACCCAGTGGCCCCTGTGGG + Intronic
941960148 2:171245477-171245499 ACTTCCCCAATTGCTCCTGTAGG + Intergenic
942508807 2:176673752-176673774 CCTTCCTGATTGGCCCCTGTTGG - Intergenic
944835902 2:203579655-203579677 GCTTCCCCTTTGCCCTCTGAAGG + Intergenic
947517336 2:230817481-230817503 GATGCCCCCTTGGCCCCAGTGGG - Intronic
948127706 2:235576884-235576906 GCCTCTCCATTGCTCCCTGTTGG + Intronic
1169281827 20:4274399-4274421 TCTTCCAAATTTGCCCCTGTAGG - Intergenic
1170497593 20:16941230-16941252 GCTTCCCCTTTGCCCTCTGGAGG - Intergenic
1172202389 20:33135701-33135723 CCTTCCCCATTCCCCCCTTTTGG - Intergenic
1172946391 20:38692869-38692891 GCTTCACATTTGGTCCCTGTGGG - Intergenic
1173547596 20:43910839-43910861 GCTTCCCCACTGGCCCCCAATGG + Intergenic
1174139790 20:48404705-48404727 GCTTCTGCATGGGCCCCAGTAGG - Intergenic
1174146548 20:48456205-48456227 GGCTCCCCCTTGGCCTCTGTGGG + Intergenic
1175294314 20:57897830-57897852 GCCTCCCCACTGGCCCCAGGAGG + Intergenic
1175403713 20:58714357-58714379 GCTTCCCCCTTGGCCTATGGTGG + Intronic
1177415982 21:20794038-20794060 GCTTCCCCTTTGCCCTCTGAAGG - Intergenic
1178112219 21:29379776-29379798 GCTTCCCCCTTTTCCACTGTAGG + Intronic
1178439030 21:32583794-32583816 TCTTCCTCATTGGACCCTGTTGG - Intronic
1181111565 22:20605755-20605777 CCTTCCCCTTTGGACCCTCTGGG - Intergenic
1181510991 22:23388632-23388654 GCTTCCCCAGTGGCCCCGAGGGG - Intergenic
1181993462 22:26856307-26856329 AAATCCCCATTGGCCCATGTTGG - Intergenic
1182430954 22:30298698-30298720 GCTTCCCCATAGTTCCCTGGGGG + Intronic
1182512631 22:30829916-30829938 GCTCCCACTTTGGCCCCCGTCGG - Intronic
1183599857 22:38833509-38833531 GTTTCCCCATTGGCCCCAAAGGG + Intronic
1185421869 22:50739261-50739283 CTCTCCCCAGTGGCCCCTGTGGG + Exonic
949872221 3:8598364-8598386 CCTTCCCAAATGTCCCCTGTTGG + Intergenic
953414033 3:42705404-42705426 GGTGCCCCAGAGGCCCCTGTGGG + Intronic
953627552 3:44583387-44583409 TCTTCTCCATTGGCTCATGTAGG - Intronic
956060336 3:65342275-65342297 GCTTCCACATCGCCCCCTGGTGG - Intergenic
958892299 3:99795270-99795292 GCTTCCCCCTTGGGCCCTATGGG - Exonic
961300888 3:125921276-125921298 GTTGCCCCATGGGCCCCTCTTGG + Intergenic
961887627 3:130106816-130106838 GTTGCCCCACAGGCCCCTGTTGG - Intronic
963807540 3:149739893-149739915 GGTTACCCATTGGTCCCTGCAGG - Exonic
965899210 3:173618089-173618111 GCTTCTCCAATGGCCTGTGTGGG + Intronic
968447948 4:661925-661947 GCTGCCACATTGGCACCTATGGG - Intronic
968918936 4:3512465-3512487 GCTTCCCCTCTGGGCCCTGTGGG - Exonic
968996757 4:3950746-3950768 GTTGCCCCACAGGCCCCTGTTGG - Intergenic
969137663 4:5043711-5043733 GCTTCTCCTTCCGCCCCTGTAGG - Intergenic
969316281 4:6383186-6383208 GCTGGCCCACTGGCCCCTGAGGG + Intronic
969817205 4:9695495-9695517 GTTGCCCCACGGGCCCCTGTTGG + Intergenic
969919834 4:10527294-10527316 GATTCCCCATGGGTCCCTGATGG - Intronic
970007908 4:11428340-11428362 GCTTCACCATAGGACCCTGTAGG - Intronic
971881710 4:32383111-32383133 GCTTCCCCAGTGGCTGCTGATGG - Intergenic
980934576 4:139214107-139214129 GCTGCCTCATGGGCCACTGTTGG + Intergenic
987207508 5:15642711-15642733 GCTTCCCCGTTGGCCTATCTAGG - Intronic
989572639 5:42959239-42959261 GCTACCTCATTGGCCCATGTGGG + Intergenic
990556346 5:56940447-56940469 GCATCCCCTGTGGGCCCTGTGGG - Intronic
991405709 5:66299504-66299526 TCTTGCCACTTGGCCCCTGTAGG + Intergenic
994343986 5:98663653-98663675 AGTTCCCCCATGGCCCCTGTGGG - Intergenic
996207424 5:120758687-120758709 GCTTCCCCTTGGCCTCCTGTTGG + Intergenic
1007185244 6:39966070-39966092 GCTTCCCACTTGGCCTCTGCTGG + Intergenic
1007741412 6:44012074-44012096 GCCTCCCCACTGGGCCCAGTTGG + Intergenic
1007820621 6:44558170-44558192 ACTTCCCCTTTTCCCCCTGTGGG + Intergenic
1007880077 6:45154882-45154904 GCTTCCCCTTTGCCCTCTGAAGG - Intronic
1009056976 6:58347971-58347993 GCTGCCTCAATGGCCCCTGATGG + Intergenic
1009347070 6:62626802-62626824 GCTTCACCAGTGGCCCAGGTAGG - Intergenic
1017984745 6:159434061-159434083 ACTTCCCCATTTGCTCCTATAGG - Intergenic
1018794127 6:167172614-167172636 CCTTCCTCACTGGACCCTGTTGG + Intronic
1019306912 7:339943-339965 GCTTCCTCCGAGGCCCCTGTGGG - Intergenic
1020321039 7:6939130-6939152 GTTGCCCCACGGGCCCCTGTTGG - Intergenic
1022258898 7:28685312-28685334 ACTTCTCCCTTGGCCCCTATGGG - Intronic
1023991809 7:45133097-45133119 GCTTCTCCATTTGGCCCTGAGGG - Intergenic
1024534403 7:50418280-50418302 GCTGCACCACTGGCCCCTGCAGG + Intergenic
1025534774 7:61934078-61934100 TTTTCCCCATAGGCCCCTATGGG - Intergenic
1026820615 7:73545586-73545608 GCTTGACCTTTGACCCCTGTGGG + Intronic
1029313942 7:99694159-99694181 GTTTCCCCATGTGCCCCTGGAGG - Intronic
1029322635 7:99778409-99778431 GTTTCCCCATGTGCCCCTGGAGG - Intronic
1030487016 7:110182376-110182398 GCATCTGCATTGACCCCTGTAGG + Intergenic
1033133100 7:138762078-138762100 GCTCCCCCATTGGAAGCTGTGGG - Intronic
1035901261 8:3460566-3460588 GCTTCCACAGTGTCCCCTCTAGG - Intronic
1036380487 8:8233245-8233267 GTTGCCCCACGGGCCCCTGTTGG + Intergenic
1036849080 8:12189415-12189437 GTTGCCCCACGGGCCCCTGTTGG - Intronic
1040132466 8:43813341-43813363 GTTTCCCCATAGGCCTCAGTGGG - Intergenic
1040293659 8:46138247-46138269 GCTGCCCCATTTTCACCTGTGGG + Intergenic
1040326340 8:46343511-46343533 GCTTCCCCGTTTGCCCTTGTGGG - Intergenic
1040728077 8:50408011-50408033 ACTTCCCCAGTTGCCCCTCTAGG - Intronic
1043421521 8:80103404-80103426 GTTTCCCCTCTTGCCCCTGTGGG + Intronic
1043876699 8:85493691-85493713 GCTTCAACATTGGCTCCTGAAGG - Intergenic
1043982478 8:86658061-86658083 GCTTCTCCATGGCCCCCTGCAGG + Intronic
1051897385 9:22002247-22002269 GCTTTCACATTTGCCCCAGTAGG + Intronic
1052095549 9:24379900-24379922 GCTTCCCCTTTGCCCACTGAAGG + Intergenic
1053611993 9:39723279-39723301 GCTTCCCCTTTGCCCTCTGAAGG - Intergenic
1053870031 9:42481273-42481295 GCTTCCCCTTTGCCCTCTGAAGG - Intergenic
1054086261 9:60747877-60747899 GCTTCCCCTTTGCCCTCTGAAGG + Intergenic
1054241526 9:62619114-62619136 GCTTCCCCTTTGCCCTCTGAAGG + Intergenic
1057673100 9:97112599-97112621 CCTTCACCATTGGGCTCTGTGGG + Intergenic
1059741936 9:117160151-117160173 CACTCCCCATTGGCCACTGTGGG - Intronic
1060664055 9:125422488-125422510 GCTTCTCCATGGGGCCCTGCAGG - Intergenic
1061062554 9:128257985-128258007 GCTTCTCCATGGCCCCCTGCAGG + Exonic
1061587019 9:131575997-131576019 GCTTCCCCAGGGGCCGCCGTGGG + Intergenic
1062206888 9:135342372-135342394 GCTCCCTCATTGGCACCTGCGGG + Intergenic
1062242972 9:135549730-135549752 GCTTCCACATCGGCCACTGCTGG - Exonic
1186553108 X:10527786-10527808 GCCTCCCAATTGCGCCCTGTGGG - Intronic
1190776261 X:53554674-53554696 GCTTCCCCACTTGGCCTTGTGGG + Exonic
1196366376 X:114928735-114928757 ACTTCCCCATTGCTCCCTGAAGG - Intergenic