ID: 904758418

View in Genome Browser
Species Human (GRCh38)
Location 1:32782904-32782926
Sequence CTGAGTAAGAAGAAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 937
Summary {0: 1, 1: 0, 2: 8, 3: 75, 4: 853}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904758416_904758418 -9 Left 904758416 1:32782890-32782912 CCTGAGGGAGACAGCTGAGTAAG 0: 1
1: 0
2: 1
3: 11
4: 204
Right 904758418 1:32782904-32782926 CTGAGTAAGAAGAAAGAGGAAGG 0: 1
1: 0
2: 8
3: 75
4: 853
904758415_904758418 2 Left 904758415 1:32782879-32782901 CCTAAAGATAACCTGAGGGAGAC 0: 1
1: 0
2: 0
3: 8
4: 112
Right 904758418 1:32782904-32782926 CTGAGTAAGAAGAAAGAGGAAGG 0: 1
1: 0
2: 8
3: 75
4: 853
904758411_904758418 9 Left 904758411 1:32782872-32782894 CCCAAGGCCTAAAGATAACCTGA 0: 1
1: 0
2: 1
3: 8
4: 164
Right 904758418 1:32782904-32782926 CTGAGTAAGAAGAAAGAGGAAGG 0: 1
1: 0
2: 8
3: 75
4: 853
904758412_904758418 8 Left 904758412 1:32782873-32782895 CCAAGGCCTAAAGATAACCTGAG 0: 1
1: 0
2: 0
3: 67
4: 1843
Right 904758418 1:32782904-32782926 CTGAGTAAGAAGAAAGAGGAAGG 0: 1
1: 0
2: 8
3: 75
4: 853

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904758418 Original CRISPR CTGAGTAAGAAGAAAGAGGA AGG Intronic
900700309 1:4044209-4044231 AAGAGGAAGAAGAAAGAGGCTGG - Intergenic
900907918 1:5573801-5573823 CTCAGCAAGAAGAATGAGGTAGG + Intergenic
901300418 1:8196337-8196359 TTGGCTAGGAAGAAAGAGGAAGG + Intergenic
901421546 1:9154538-9154560 CTGACTCAGGAGGAAGAGGAAGG - Intergenic
902220081 1:14959075-14959097 CGGAGAAAGAGCAAAGAGGAAGG + Intronic
903056153 1:20637651-20637673 CTGAATAATGAGAAAGAAGATGG + Intronic
903611867 1:24620737-24620759 CTAAGTAAGTAGATAGATGAGGG - Intergenic
903857771 1:26346716-26346738 CAGAGGAATAAGAAAGATGAGGG + Intronic
904758418 1:32782904-32782926 CTGAGTAAGAAGAAAGAGGAAGG + Intronic
906559186 1:46742548-46742570 GTGAGTAAAAAGAAAGGAGATGG + Intergenic
906814872 1:48868326-48868348 CTGCTTAAGCAGAAAGGGGAAGG + Intronic
906822563 1:48944727-48944749 TTGATCAAGAAGAAAGGGGAAGG - Intronic
907177195 1:52535583-52535605 CACAGAAAGAAGAAAGAGAAGGG + Intronic
907298950 1:53473709-53473731 CTGAGTCAGAATAAATGGGATGG - Intergenic
907379949 1:54078738-54078760 CTAAGTAAAAGGAAAGATGAAGG + Intronic
907786187 1:57615164-57615186 CTAAGAAAGAAGACAGAGGCCGG - Intronic
908640710 1:66220103-66220125 CTAAGTAAAAGGAAAGAAGAGGG + Intronic
908871891 1:68622622-68622644 CTGAGTTTGAAGATAGAGGAAGG - Intergenic
908888146 1:68813693-68813715 CTGACTTTGAAGAAGGAGGAAGG + Intergenic
909342858 1:74551078-74551100 CAGAGTGAGAAGGGAGAGGAGGG - Intergenic
909532928 1:76700848-76700870 CAGTGTAAGAAGGGAGAGGATGG - Intergenic
909549969 1:76887044-76887066 CTGAGAAGGAAGAAAAAAGAGGG - Intronic
909882581 1:80898719-80898741 ATGAGAAAAAGGAAAGAGGAGGG - Intergenic
910007728 1:82419267-82419289 CTGAGCAAGAAGACAAAGAAGGG - Intergenic
910176310 1:84434551-84434573 CTGAGTTAGAAAAAACAGGCTGG - Intergenic
910238020 1:85055805-85055827 CGGAGAAAGGAGAATGAGGAAGG + Intronic
910265222 1:85331218-85331240 ATGAGTAAGAAGCAAGAGAATGG - Intronic
910680607 1:89860400-89860422 CTTACTAAGGAGAAAGATGAAGG - Intronic
910819192 1:91328221-91328243 CAGACTAAGAAGAAAAAGAAGGG + Intronic
910910400 1:92227983-92228005 CTGAGAAAGAGAAAAGAGAATGG - Intronic
911833943 1:102592160-102592182 CTGAGAAAAAATAAAGATGATGG + Intergenic
911971238 1:104440516-104440538 CTGGGTAAAAAGCAAGTGGATGG - Intergenic
911991970 1:104709858-104709880 GCTAGTAAGAAGAAAGAAGATGG - Intergenic
912400564 1:109388015-109388037 CTCAGGATGAAAAAAGAGGAGGG - Intronic
912891367 1:113535459-113535481 TTGAGTTAAAAAAAAGAGGAAGG - Intronic
914082975 1:144426538-144426560 CTGTTTAAAAAGAAAAAGGACGG + Intronic
914918626 1:151833065-151833087 ATGAGTAGTGAGAAAGAGGAGGG + Intergenic
914963508 1:152229057-152229079 ATGAGTCAGAAGACAGATGAAGG + Intergenic
914998646 1:152566501-152566523 CTGCCTGAGTAGAAAGAGGATGG + Intronic
915341077 1:155177172-155177194 CTGAGGGGGAAGAAAGAGGTGGG - Intronic
915447661 1:155983311-155983333 ATGGGAAGGAAGAAAGAGGAAGG + Intronic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
915816603 1:158973715-158973737 AAGTGTCAGAAGAAAGAGGAGGG - Exonic
915952575 1:160199221-160199243 CTGAGCAAGGGGAAACAGGACGG + Intronic
916326453 1:163565266-163565288 ATGACTAAGAAGACAAAGGAAGG - Intergenic
916368192 1:164057778-164057800 ATGAATGAGAAGAAAGAGGAAGG - Intergenic
916427963 1:164699762-164699784 GTGAGAAAGAATAAAGGGGATGG - Intronic
916777712 1:167985412-167985434 CTGGGTTTGAAGATAGAGGAAGG - Intronic
917175084 1:172225114-172225136 AAGAGGAAGAAGAAACAGGAGGG - Intronic
917250428 1:173053639-173053661 CTGTTTAAGAAGAGAGAGGAGGG + Intergenic
917498117 1:175561039-175561061 CTGAATTAGAAGAACAAGGAAGG - Intronic
918124463 1:181570669-181570691 CTGACTCTGAAGATAGAGGAAGG - Intronic
918331120 1:183461502-183461524 TTGAGAAAGAAGAAAGAATAGGG - Intergenic
918448269 1:184635358-184635380 GGGAGAAAGAAGAAGGAGGAAGG - Intergenic
918477987 1:184946465-184946487 CTCAAAAAGAGGAAAGAGGAAGG + Intronic
919354018 1:196498428-196498450 CAGAATTAGAAGAAAGAGGGAGG - Intronic
919935926 1:202250941-202250963 CTGAGGAAGAATGTAGAGGAAGG - Intronic
920447858 1:206033484-206033506 CTGACTGTGAAGACAGAGGAAGG - Intergenic
920903503 1:210136312-210136334 ATGAGTAAGGAGAAAGGGAACGG + Intronic
920970622 1:210740814-210740836 GAGAGTGAGAAGGAAGAGGAGGG + Intronic
921039237 1:211414496-211414518 CTGAGCAAAAAGAAAAAAGAAGG + Intergenic
921233214 1:213095251-213095273 CAGAGTAAAAAGAAAGAGAGAGG - Intronic
921261647 1:213389671-213389693 CTGGGTAAAAAGAAAGGGAAGGG - Intergenic
921383106 1:214544852-214544874 GTGAGAGAGAAAAAAGAGGAGGG + Intronic
921482885 1:215683711-215683733 GTGAATAAGAAGAAAGAGAAAGG - Intronic
921787220 1:219245074-219245096 AAGAGAAAGAAGAAAGAGGAAGG - Intergenic
921841850 1:219836630-219836652 CTGAGATTGAAGAAAGAGGCTGG - Intronic
921952976 1:220951984-220952006 CTGAGTTAGAAGAAGTAAGAAGG + Intergenic
922061744 1:222099223-222099245 CTTAGCTAGAAGAAGGAGGAGGG + Intergenic
922416214 1:225425649-225425671 CCAAGTACAAAGAAAGAGGAAGG + Intronic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922596237 1:226815635-226815657 CAGAGGAAGGAGAAAGAGGTGGG - Intergenic
922894342 1:229088771-229088793 CAAGGTAAGGAGAAAGAGGAGGG + Intergenic
923145891 1:231197527-231197549 CGTATTAAGAAGAAAGAGGCGGG + Intronic
923314058 1:232762298-232762320 CTGAGGAAGAGGAAGAAGGATGG - Intergenic
923908056 1:238407972-238407994 TTCAGACAGAAGAAAGAGGATGG + Intergenic
924222839 1:241895880-241895902 CTGAATAATAAGAATGTGGAAGG - Intergenic
924223070 1:241898131-241898153 CTGAATAATAAGAATGTGGAAGG - Intergenic
924358298 1:243208062-243208084 CTGAGCAATATGAAAAAGGAAGG - Intronic
924582835 1:245336273-245336295 CTCAGAAAGAAGAGAGAGGAAGG + Intronic
924897692 1:248360169-248360191 GTGAGTAGCAAGATAGAGGAAGG + Intergenic
1063194287 10:3726767-3726789 GTGAGAAAGAAAAAAAAGGATGG - Intergenic
1063354718 10:5387356-5387378 CTGAGTAAGAACAAAAGGAAAGG - Intergenic
1063379305 10:5574483-5574505 CTGAGTAAGAAGAGTAAGGCTGG + Intergenic
1063817558 10:9793163-9793185 ATTAGTCAGATGAAAGAGGAGGG + Intergenic
1064697018 10:17976895-17976917 CAGAGAAAGGAGAAAGAGAAAGG - Intronic
1065041567 10:21703048-21703070 CAAAGTAAGAAGAAAGAGAAAGG - Intronic
1065229178 10:23579511-23579533 TTGAGCAAAAGGAAAGAGGAGGG + Intergenic
1065763907 10:29008860-29008882 CTGAGCAAGAACAATGAGAAGGG + Intergenic
1065806128 10:29395004-29395026 CTCAGAAAGGAGAAAGGGGATGG - Intergenic
1065859328 10:29858354-29858376 CTGGGAAAGGAGAAAGAGGCAGG + Intergenic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1067724662 10:48761014-48761036 CTGAGGTAGAAGAATGAGAATGG + Intronic
1068831330 10:61498647-61498669 CTGATTACCAAGAAAGAGGGTGG - Intergenic
1068884234 10:62082008-62082030 TTAAGAAAGAAGAATGAGGAGGG + Intronic
1068915913 10:62431220-62431242 TTAAGTAGGAAGAAAGAGCAGGG - Intronic
1068923548 10:62511367-62511389 CTTACTAAGAAAAAAGATGAAGG + Intronic
1069011282 10:63375990-63376012 CTGAGAAAGAAGAAAGTTGACGG + Intronic
1069058724 10:63871677-63871699 AAGAGTGAGAGGAAAGAGGATGG + Intergenic
1069108419 10:64411822-64411844 ATGAGGAAGAAAAAAGAGAATGG + Intergenic
1069195301 10:65544130-65544152 CTGATTAAGAATAAGAAGGAGGG - Intergenic
1069420504 10:68242297-68242319 GTGAGTAATGAGAAAAAGGAGGG - Intergenic
1069772022 10:70906165-70906187 GAGAGTAAGAAGAAACAGGATGG - Intergenic
1070408894 10:76121221-76121243 GTGAGTAGAAAGAAAGAGGAAGG + Intronic
1070444615 10:76484153-76484175 GAGAGGAAGAAGAAGGAGGATGG - Intronic
1070647715 10:78212957-78212979 ATGAGGAAGAGGAAAGAAGAGGG - Intergenic
1070692384 10:78536768-78536790 ATGAGTATGGAGAAAGAAGAGGG - Intergenic
1071222595 10:83486935-83486957 CTGAGAAAGTAGAAATAGCATGG + Intergenic
1071444897 10:85736304-85736326 GAGAGAAGGAAGAAAGAGGAAGG + Intronic
1071510666 10:86260639-86260661 ATGAGTAAGAAGGCAGAGGTGGG + Intronic
1071730559 10:88244265-88244287 CTGAGGAACAAGGAGGAGGAGGG - Intergenic
1071847985 10:89539326-89539348 CTGAGTAGGGAAGAAGAGGAAGG - Intronic
1071948472 10:90675505-90675527 CTGAGTAGGAAGTCAGAAGAGGG + Intergenic
1072151422 10:92688164-92688186 CTGACTATGAAGAAAGGGGTGGG - Intergenic
1072436168 10:95416218-95416240 CAGGGAAAAAAGAAAGAGGAGGG + Intronic
1072481974 10:95817739-95817761 CTGAGGAGGAAGAAAAAGCAAGG - Intronic
1072875030 10:99163417-99163439 CTGAGGAGGTGGAAAGAGGAAGG - Intronic
1073048270 10:100652757-100652779 CTGAGGTAGAAGAAAGAGCATGG - Intergenic
1073580357 10:104660043-104660065 CTGTGTGAGAAAAAAGAGAAAGG - Intronic
1073609993 10:104933809-104933831 CAGAGTAAGACAAAAAAGGAAGG - Intronic
1073949334 10:108787798-108787820 TTTAGGAAGAAGAAAGAGAAAGG - Intergenic
1074395771 10:113096875-113096897 CAGAGAAAGAAGAAATAAGAGGG + Intronic
1075116244 10:119629519-119629541 CAGAGTAAGAAGCAACAGGCTGG - Intergenic
1075204837 10:120437853-120437875 CTGAACATGATGAAAGAGGAAGG - Intergenic
1075476754 10:122742152-122742174 CAGAGTAAGAAGAAAAGAGATGG + Intergenic
1076030137 10:127150336-127150358 CTGAGCAAAGAGAAAGGGGAGGG - Intronic
1076305013 10:129460038-129460060 GTGAGGATGCAGAAAGAGGATGG + Intergenic
1077345235 11:2045337-2045359 CGGAGTATAAAGAAAGAGGATGG - Intergenic
1077479332 11:2806284-2806306 GTGAGGAAGAAGAGAGGGGAGGG + Intronic
1077588692 11:3474762-3474784 ATGGGTAATAAGAAAAAGGATGG + Intergenic
1078090484 11:8261915-8261937 GTGTGTAGGAAGAGAGAGGATGG - Intronic
1078373729 11:10774866-10774888 TTGGGAAAGAAGGAAGAGGAAGG + Intronic
1078846483 11:15123448-15123470 CTGAGTAACCAGATAGATGATGG + Intronic
1078953496 11:16162935-16162957 AAAAGTGAGAAGAAAGAGGAAGG + Intronic
1078953508 11:16163094-16163116 AAGAGTATGAAAAAAGAGGAGGG + Intronic
1079431827 11:20397486-20397508 TTGAGGAAGAGGAAAGGGGAGGG - Intronic
1079652879 11:22951763-22951785 CTGAGAAAGAAGAAAGAAGATGG - Intergenic
1079849706 11:25516090-25516112 CAGAGAAAGAAAGAAGAGGAGGG - Intergenic
1079879084 11:25900930-25900952 GGGAGAAATAAGAAAGAGGATGG - Intergenic
1079978522 11:27123926-27123948 CTGGGAAAGAAGTAAAAGGAAGG - Intronic
1080709628 11:34734389-34734411 CTGAGCATGCAGAAAGAGGATGG - Intergenic
1080785363 11:35470445-35470467 CTGAGAAAAAAGAAATAGCAAGG - Intronic
1081041813 11:38223087-38223109 TTGGGGAAGAAGAAAGAGAAAGG + Intergenic
1081225288 11:40513823-40513845 CTGAGTAAGAAAAAAGAAAATGG - Intronic
1081711819 11:45221737-45221759 CTGAGCAGTAAGAAATAGGAAGG + Intronic
1082016968 11:47496800-47496822 CTGACTAAGAATAAAGAGGTAGG + Intronic
1082711283 11:56556940-56556962 GTCAGAAAGAAGAAAGATGATGG + Intergenic
1082917404 11:58452437-58452459 ATGAATAAGAAGAAAGGGAAAGG + Intergenic
1083738996 11:64697825-64697847 CAGAGAGAGAAGAAAAAGGAGGG + Intronic
1084161829 11:67354201-67354223 CTGAGTAGGAAGGCAGAGCAAGG + Intronic
1084244387 11:67846389-67846411 ATGGGTAATAAGAAAAAGGATGG + Intergenic
1084828300 11:71748172-71748194 ATGGGTAATAAGAAAAAGGATGG - Intergenic
1085187009 11:74584097-74584119 ATGACGAAGAAGACAGAGGAGGG + Intronic
1085461899 11:76699080-76699102 GTGAGGAAGAAGAGAGAGAAGGG - Intergenic
1085698227 11:78723655-78723677 CAGACTAAAAAGAAACAGGATGG - Intronic
1086047293 11:82547878-82547900 AAGAGAAAAAAGAAAGAGGAGGG + Intergenic
1086364809 11:86098137-86098159 CAGATTAGGAAAAAAGAGGAAGG + Intergenic
1087126385 11:94630366-94630388 CTGAGAAGGAAGGAAGAGGAGGG + Intergenic
1087294038 11:96348891-96348913 CTGAGCAAAAAGAAAAAGGCTGG - Intergenic
1087587478 11:100140642-100140664 ATGAGTTAGAGGACAGAGGAGGG + Intronic
1088134694 11:106540392-106540414 CAGAGCAGGAAGTAAGAGGAGGG - Intergenic
1089624765 11:119744296-119744318 GTGATGAAGAAGAAAGGGGATGG - Intergenic
1089848135 11:121474468-121474490 CTACGTAATAATAAAGAGGAGGG - Intronic
1089890953 11:121880122-121880144 CTGAGAAAGAAGCCAGTGGATGG - Intergenic
1089920677 11:122206749-122206771 CTGAGGAGGAAGAAGGAGGCCGG + Intergenic
1090082055 11:123620175-123620197 CTAAGTAAGGAAAAAGAGGCCGG + Intronic
1090570400 11:128038598-128038620 CTGACTTGGAAGAAGGAGGAGGG - Intergenic
1090591404 11:128274056-128274078 CTGTGAAAGAACAAAAAGGAAGG + Intergenic
1090767527 11:129889505-129889527 AAGAGTGAGAAGAAACAGGATGG + Intronic
1090990193 11:131810286-131810308 GGGAGTAAGAAGAAATATGAGGG - Intronic
1091612825 12:2025613-2025635 TTGAGTCAGAAGACAGAAGATGG - Intronic
1092069580 12:5621816-5621838 AAGAGGAAGAAGAAAGAGAAGGG + Intronic
1092092246 12:5812589-5812611 AAGAGGAAGAAGAAAAAGGAAGG + Intronic
1092171580 12:6376656-6376678 GTGAGCAAGGAGAGAGAGGAGGG + Intronic
1092247272 12:6870696-6870718 CGGTGTAAGAAGGGAGAGGATGG - Exonic
1092414954 12:8283533-8283555 ATGGGTAATAAGAAAAAGGATGG + Intergenic
1092563272 12:9638309-9638331 CTCAGAAAGAACAAACAGGATGG - Intergenic
1092860063 12:12712609-12712631 CAAAGCAAGGAGAAAGAGGAAGG - Intergenic
1093103999 12:15064149-15064171 TTGAGAAATAAGAAAGAGTAAGG - Intergenic
1093105885 12:15086583-15086605 CTGACTTTGAAGAAGGAGGAAGG - Intergenic
1093622742 12:21311923-21311945 CTCAAAAAGAAGAAAGAAGAAGG + Intronic
1094094499 12:26688539-26688561 CAGAGGAAGAAGAAGGAGAAGGG + Intronic
1094129871 12:27063353-27063375 AGGAGGAAGAAGAAAGAAGAAGG - Intronic
1095538889 12:43285318-43285340 CTGAGAAACAAGAAGGAGGTTGG - Intergenic
1095734430 12:45541181-45541203 GGGAATAAGAAGAGAGAGGAGGG - Intergenic
1095985456 12:47996328-47996350 GTGACTAAGAAGAATGAAGATGG - Intronic
1096836852 12:54356669-54356691 CCGAGTGAGAAGACAGTGGAAGG + Intergenic
1097342584 12:58455790-58455812 GTCAGTAAGCAGAAAGAGCAAGG - Intergenic
1097368476 12:58746231-58746253 GTGAGTATGAAGTGAGAGGAGGG + Intronic
1097710506 12:62912452-62912474 CTGAGGCAGAAGGAATAGGAGGG + Intronic
1097729169 12:63108031-63108053 CGGAAGAAGGAGAAAGAGGAAGG - Intergenic
1098194935 12:67989723-67989745 GGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1098498063 12:71159994-71160016 CTGCCTAGGAAGAAAGGGGAGGG - Intronic
1098777323 12:74636889-74636911 CTGAGAATGAACAAATAGGAAGG - Intergenic
1098957722 12:76704826-76704848 CTGAGCAAACAGAAAGATGAAGG - Intergenic
1098986073 12:77013728-77013750 CTGAGGAAGAGGAAGGAGAAGGG - Intergenic
1099601266 12:84741244-84741266 CTGAGAAAGAAGAAAGATGAAGG + Intergenic
1099895803 12:88645109-88645131 GTGGGTAAGTAGAAACAGGAAGG - Intergenic
1099923210 12:88984776-88984798 CTGAGAAAGAAGACATAAGAAGG + Intergenic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1100085833 12:90909354-90909376 GTGAGAAAAAAGAAAGAAGAGGG + Intronic
1101537059 12:105628243-105628265 ATGAGAAAAAAGAAAGAGGGGGG + Intergenic
1102726828 12:115073074-115073096 ATGAGTTAGAAATAAGAGGATGG + Intergenic
1102861133 12:116337551-116337573 CGGAGAAAGAAGAGAGAGGTCGG - Intergenic
1103044826 12:117727395-117727417 CAGAAAAAGAAGAAAGAAGAAGG + Intronic
1103411920 12:120718337-120718359 CTGATTAAGAAAAAAGTGAAGGG - Intronic
1103539260 12:121654525-121654547 CTGAGGAAGAAGGAAGAAGCTGG - Intronic
1104839913 12:131818511-131818533 CTGAGAAAGGAGTCAGAGGAGGG - Intergenic
1105955988 13:25283123-25283145 GTGAGTAAGAACAGAGAGGAGGG - Intronic
1106007625 13:25785834-25785856 ATGAGGAAGAAGATAAAGGAAGG + Intronic
1106384200 13:29268204-29268226 ATGAGTAGCAAGAATGAGGAAGG + Intronic
1106949731 13:34870017-34870039 CAGAGTAAGAAGATACAGGCAGG + Intergenic
1107174617 13:37386056-37386078 CTGAGTATGAGGGAAGAGGGAGG - Intergenic
1107238992 13:38209856-38209878 CTGAGTATAAAGGTAGAGGAGGG + Intergenic
1108293501 13:48987517-48987539 CTGACTAAGAAGGGTGAGGATGG + Intronic
1108479586 13:50855137-50855159 GAAAGGAAGAAGAAAGAGGAGGG + Intergenic
1108747709 13:53411779-53411801 TTATGTAAGAAGACAGAGGAGGG - Intergenic
1108835704 13:54545251-54545273 CTGAGTAATTAGAAAAAGGTAGG + Intergenic
1109418635 13:62079164-62079186 CAGAATAAAAAGAAAGAGAATGG - Intergenic
1109730199 13:66403041-66403063 CTGAGAAAGAAGAAAAAGACAGG + Intronic
1109865621 13:68260005-68260027 CTGAGAAAGAACAAAAGGGATGG + Intergenic
1110047876 13:70854228-70854250 CTGAATAGGTAGAAAGAAGATGG - Intergenic
1110150629 13:72248718-72248740 CAGAATAAGAGGAAAAAGGATGG + Intergenic
1110153691 13:72287046-72287068 CTGACTTAGAAGAAATAGAAAGG - Intergenic
1110534832 13:76639028-76639050 GTGAGTCTGAAGAGAGAGGAAGG - Intergenic
1110700387 13:78540626-78540648 CTCTGCAAGAAGAAGGAGGATGG - Intergenic
1111031304 13:82603019-82603041 CAGAGAAAGAAGACAGAAGAGGG - Intergenic
1111171433 13:84531646-84531668 TTGATTAAGAAAAAAGAAGAGGG + Intergenic
1111218462 13:85175369-85175391 CTGCTGAAGAAGAATGAGGAAGG + Intergenic
1111456143 13:88486831-88486853 TTGAGTTAGAAGAAATTGGAGGG - Intergenic
1111473558 13:88718045-88718067 CAGAGAAAGAAAGAAGAGGAGGG + Intergenic
1112289442 13:98132225-98132247 CTGAGGAAGAATAAGGAGGTGGG - Intergenic
1112555351 13:100463066-100463088 CTGATGATGGAGAAAGAGGACGG + Intronic
1113186911 13:107698101-107698123 ATCAGTAAAAAGAATGAGGATGG - Intronic
1113266065 13:108619643-108619665 CTGGCCAAGAAGAAAGGGGAAGG + Intronic
1114210674 14:20611545-20611567 GTGAGTGAGAAGGAGGAGGAGGG + Intergenic
1115388050 14:32820813-32820835 CTGAATAGGAACACAGAGGAAGG + Intronic
1115506295 14:34097318-34097340 CTGACTTGGAAGAAAGAGAATGG - Intronic
1115659106 14:35474438-35474460 AGGAGGAAGAAGAAAGAAGAAGG - Intergenic
1116344431 14:43773195-43773217 CTGAGTTGTAAGAAAAAGGAAGG - Intergenic
1116628404 14:47297387-47297409 GAGAGAAAGAAGAAAGAGGAAGG + Intronic
1116863742 14:50014948-50014970 GAAAGAAAGAAGAAAGAGGAAGG + Intergenic
1117339031 14:54778199-54778221 TTCAGTATGAACAAAGAGGAAGG - Intronic
1118012706 14:61626278-61626300 ATGAGTGAGAGGAGAGAGGATGG - Intronic
1118088448 14:62445511-62445533 CAGAGTAATAAGAAAAAGGAGGG - Intergenic
1118139423 14:63064324-63064346 GAGAGTGAGAAGAAAGAGAAGGG + Intronic
1118383735 14:65238491-65238513 CTAAGAAGAAAGAAAGAGGAAGG - Intergenic
1118482618 14:66182239-66182261 CTGAGAGAAAAGAAAAAGGAAGG + Intergenic
1118807677 14:69251778-69251800 CTGAGGTAGAAGAAAGAGGAAGG + Intergenic
1118979104 14:70701716-70701738 GGGGGTGAGAAGAAAGAGGAAGG + Intergenic
1119094807 14:71819541-71819563 TTAAGAAAGAAGAAAGAGGGTGG - Intergenic
1119356489 14:74011335-74011357 TTGAGTGAGAAGAAAGTGTAGGG - Intronic
1119770707 14:77219203-77219225 CTCAGCAATGAGAAAGAGGAAGG - Intronic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1120728792 14:87978344-87978366 CTCTGTAAGAATAAAGAGGCCGG - Intronic
1120945900 14:89996747-89996769 GGGAGTAAGAAGAAAGGGGCAGG + Intronic
1121081936 14:91115312-91115334 CTGAGGAAGCAGGAAGGGGAAGG + Intronic
1121090330 14:91176942-91176964 GAGAGAAAGAAGAAAGAAGAAGG - Intronic
1121861669 14:97324433-97324455 CTGAATCAGCAGAAACAGGAAGG - Intergenic
1121926837 14:97934712-97934734 CTGACTTTGAAGAAAGAGGAAGG + Intronic
1122419551 14:101566852-101566874 TTGAGCAAGGAGAGAGAGGAGGG + Intergenic
1122595093 14:102885049-102885071 CTGAGAAAGAAGGGAGTGGAGGG - Intronic
1122756385 14:103983769-103983791 CTGAGTAACAAGGCAGAGGATGG + Intronic
1123485241 15:20729800-20729822 CTGAGTAAGCAGAGCGAGAAAGG - Intergenic
1123541729 15:21298849-21298871 CTGAGTAAGCAGAGCGAGAAAGG - Intergenic
1124858093 15:33410469-33410491 CTGAGTTTGAATAATGAGGATGG - Intronic
1125214163 15:37250615-37250637 CTGAGTAAGGAGACAGAAGATGG - Intergenic
1125311483 15:38383532-38383554 CTGAATTAGAAGAAAGAAGTTGG + Intergenic
1125766278 15:42138623-42138645 CTGAGTATGAGGACAGAGGCTGG - Intergenic
1125796860 15:42409764-42409786 CTGAGGAGGAAGGGAGAGGAGGG - Intronic
1127701075 15:61501805-61501827 CTGAGTAAAAACAAAGAGAAAGG + Intergenic
1128041182 15:64574868-64574890 CTGATTTTGAAGCAAGAGGAGGG + Intronic
1128095622 15:64952357-64952379 AAGAGGAAGAAGAAAGAAGAAGG - Intronic
1128095772 15:64954055-64954077 AAGAGGAAGAAGAAAGAAGAAGG - Intronic
1128647097 15:69385715-69385737 GTGTATATGAAGAAAGAGGATGG - Intronic
1128765188 15:70247049-70247071 CTGAGTCAAAATAAAGAGGAAGG - Intergenic
1128969426 15:72094210-72094232 AGAAGAAAGAAGAAAGAGGAAGG + Intronic
1129275327 15:74441683-74441705 CTGGGTAAGCAGAAAGAGGGAGG + Intergenic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130424969 15:83787826-83787848 TTGAGAAAGGAGAAAGAGGAGGG - Intronic
1130795137 15:87199860-87199882 AAGAAAAAGAAGAAAGAGGAAGG + Intergenic
1130831612 15:87606912-87606934 TTCAGTAAGGACAAAGAGGAGGG + Intergenic
1131018708 15:89079775-89079797 CTGAGCTAGAAGAAGGAGGGAGG - Intergenic
1131439286 15:92446872-92446894 GTGAGCAAGGAGAAAGGGGAAGG + Intronic
1131670524 15:94614974-94614996 CTGGACAAGAAGAAAGGGGAGGG - Intergenic
1131737997 15:95354885-95354907 CTGAATAAGAAGACAGGGCAGGG + Intergenic
1131857287 15:96610619-96610641 TTGACTTAGATGAAAGAGGAAGG + Intergenic
1202950044 15_KI270727v1_random:25991-26013 CTGAGTAAGCAGAGCGAGAAAGG - Intergenic
1133435653 16:5777256-5777278 CTGACTATGAAGGTAGAGGAAGG - Intergenic
1134287185 16:12872041-12872063 AAGAGGAAGAAGAAGGAGGAGGG - Intergenic
1134377864 16:13695169-13695191 CAGACTAAGGAAAAAGAGGAGGG + Intergenic
1134555689 16:15162068-15162090 CTGAAAAAGAAAAAAGAAGAAGG - Intergenic
1134913879 16:18052953-18052975 CAGAGAAAGAAGGAAGAGCAGGG - Intergenic
1134916271 16:18073779-18073801 CTGAAAAAGAAAAAAGAAGAAGG - Intergenic
1135521429 16:23181686-23181708 GAGAGAAAGAAGAAAGAGGGAGG + Intergenic
1135526114 16:23214935-23214957 CAGAGTAAGAGGAAACAGGAAGG + Intronic
1135807006 16:25552058-25552080 CTGAGTAGGAGGCAGGAGGATGG - Intergenic
1135942427 16:26834217-26834239 GTGAAGAAGAAGGAAGAGGAGGG + Intergenic
1136112208 16:28070779-28070801 CTGAGGAGGGAGAACGAGGAAGG + Intergenic
1136254321 16:29028343-29028365 GTGAGGACGAAGAAAGAGCAGGG - Intergenic
1136477714 16:30524052-30524074 CTGAGGAAGAAGAGGGAGGCTGG + Exonic
1136498516 16:30658452-30658474 CTGAGGAGGAAGAGGGAGGAGGG + Exonic
1136656444 16:31712092-31712114 CTGAGTGGGAAGTAAGAGGGTGG + Intergenic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137627419 16:49918318-49918340 CGGAGTAAGAAGAGTGAGGACGG + Intergenic
1137952389 16:52796042-52796064 CTGATTTTGAAGACAGAGGAAGG + Intergenic
1137953254 16:52803635-52803657 AGGAGGAAGAAGAAAGGGGAAGG + Intergenic
1138079649 16:54077761-54077783 CTGAGTCAGAAGGAAGAGGTAGG + Intronic
1138154065 16:54686171-54686193 CTCAATAAAAAGAAAAAGGAAGG - Intergenic
1138966619 16:62092211-62092233 CTGATTAATAAGAAACAAGAGGG + Intergenic
1139079796 16:63502519-63502541 CTGAGCATGAAGAAAGAAAAAGG + Intergenic
1139371967 16:66474531-66474553 GGGAGGAAGAAGAAAGAGGGAGG + Intronic
1139935187 16:70565338-70565360 CAGAATAAGAAGCAAGAGTAAGG - Intronic
1141082019 16:81061088-81061110 ATGAGAGAGAAGAAAGAGAAAGG + Exonic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1141584279 16:85022983-85023005 CTGACTAGGCAGACAGAGGAAGG + Intergenic
1142358081 16:89613535-89613557 CTCTGAAAGTAGAAAGAGGAGGG - Intronic
1142875308 17:2848906-2848928 CTTAGGAGGAAGACAGAGGAGGG - Intronic
1143214163 17:5211707-5211729 CTCTCTAAGAAGAAAGGGGATGG + Intronic
1143217767 17:5237929-5237951 CTGAGTGAGAAGAAACAAAACGG - Intergenic
1143918858 17:10315026-10315048 ATAATGAAGAAGAAAGAGGAGGG + Intronic
1144126806 17:12210497-12210519 GAGAGGAAGAAGGAAGAGGAAGG - Intergenic
1144255404 17:13462654-13462676 CTGATTATAAACAAAGAGGAGGG + Intergenic
1144431464 17:15196022-15196044 CTAAGCAAAAAGCAAGAGGAAGG + Intergenic
1144673448 17:17146066-17146088 CTGACTAAGCAGTATGAGGACGG + Exonic
1144722895 17:17484610-17484632 CTGAGGGAGAAGAAAGTGAACGG - Intronic
1144783341 17:17818662-17818684 CAGAGAAAGCAGGAAGAGGATGG - Intronic
1144889667 17:18487416-18487438 AGGAGTGAGAAGAAAGGGGAAGG + Intronic
1145142544 17:20456880-20456902 AGGAGTGAGAAGAAAGGGGAAGG - Intronic
1145238733 17:21227088-21227110 CGGAGTCAGAAGAAGGAGGATGG + Intergenic
1145247858 17:21281399-21281421 TAGAGGAAGAAGAAAGAGGAAGG + Intergenic
1145857607 17:28177128-28177150 CTGAGGAGGAAGAGAAAGGAGGG + Intronic
1145864465 17:28231737-28231759 ATGGGTAATAAGAAAAAGGACGG + Intergenic
1146533589 17:33631056-33631078 CTGGGTAAGGAGCAAGTGGAAGG + Intronic
1146573092 17:33969519-33969541 CTGGGGAACAAGAAAGGGGAAGG + Intronic
1146673679 17:34758586-34758608 AGGAGAAAGAAGAAGGAGGAAGG + Intergenic
1147528234 17:41247703-41247725 GAAAGAAAGAAGAAAGAGGAAGG + Intronic
1148208127 17:45792270-45792292 CAGAGTTGGCAGAAAGAGGAAGG - Intronic
1148327848 17:46794203-46794225 CTGAGAGAAAAGGAAGAGGATGG + Intronic
1148336401 17:46844826-46844848 GAAAGAAAGAAGAAAGAGGAAGG - Intronic
1148874816 17:50680684-50680706 CTGAGAGAGAAGAAAGAGAAGGG - Intronic
1148972777 17:51498815-51498837 CTTAATAAGAAGGAAGAGGGAGG - Intergenic
1149173950 17:53846771-53846793 CTGGCTTTGAAGAAAGAGGAAGG - Intergenic
1149443138 17:56691712-56691734 TCTAGTAAGAAGAAAGGGGAAGG - Intergenic
1149479634 17:56992319-56992341 CTGAGTCAGCATGAAGAGGAGGG + Intronic
1149558068 17:57588317-57588339 CTTATTAAGAAGAAAGAAAAGGG - Intronic
1149612467 17:57967635-57967657 CTGAGGGAGAAGAATGGGGAGGG - Intergenic
1149731342 17:58949664-58949686 CAGAGAAAGAAGAAAGAGAAAGG - Intronic
1149865214 17:60147835-60147857 CAGAGTAAGAGGAAGGAGGCTGG + Intergenic
1149958733 17:61082888-61082910 GTGAGGAAGAAAAAACAGGAGGG - Intronic
1150977233 17:70102184-70102206 GTGAACAAGAAGAAAGAAGAAGG - Intronic
1151177091 17:72297671-72297693 CTCAGTAGGAAGAAAGAAGCTGG - Intergenic
1151316747 17:73327388-73327410 ATGAGAAAGAAGAGAGAGGCTGG - Intergenic
1151463262 17:74268422-74268444 CTGAGAAAGAATAAAGAAGCAGG + Intergenic
1151887552 17:76932130-76932152 CTGTGTAAGAAGAAGAAAGAAGG - Intronic
1152307170 17:79527925-79527947 CTGACTCGGCAGAAAGAGGAAGG - Intergenic
1152985036 18:313423-313445 TGGCGTAAGAGGAAAGAGGAGGG + Intergenic
1153904949 18:9652960-9652982 CTGATTTTGAAGATAGAGGAAGG - Intergenic
1154052095 18:10970722-10970744 GTGAGTCAGGAGAAAGAGGAAGG + Intronic
1154450377 18:14470857-14470879 ATGAGCAATAAGACAGAGGATGG + Intergenic
1156139710 18:34091735-34091757 CTGATGCAGGAGAAAGAGGACGG + Intronic
1156242732 18:35268994-35269016 CTGAATAGGAGGAAAGTGGAGGG + Intronic
1156354009 18:36325706-36325728 CAGAGTAAGAAGAAAAGAGAGGG - Intronic
1156504346 18:37579603-37579625 CTGGGGAAGAGCAAAGAGGAAGG + Intergenic
1157316520 18:46594387-46594409 CTGGATGAGAAGAAAGCGGATGG - Intronic
1157497907 18:48169615-48169637 TTGATAAAGAAGAAAGTGGACGG - Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1158029068 18:52940316-52940338 CAGAGTAAGAAGTCAGAGTAGGG + Intronic
1158087434 18:53669028-53669050 CTGAGTACAAAGAAAGTAGAAGG - Intergenic
1158318415 18:56237379-56237401 CTGGGTTTGAAGAAGGAGGAAGG + Intergenic
1158617515 18:59001765-59001787 ATAAGTATGAAGAAAGAGGAAGG - Intergenic
1158726184 18:59974979-59975001 CAGAGTCAGTAGAAAGAGAAAGG + Intergenic
1158993976 18:62898414-62898436 CACAGTGAGAAGAAAAAGGAAGG - Intronic
1159603924 18:70455297-70455319 CTGAGTACGAATAAAGATAAAGG - Intergenic
1160829460 19:1096533-1096555 CTACGGAAGAAGAAAGAGCAGGG + Intergenic
1161344130 19:3759599-3759621 CTCTGGAAGAAGATAGAGGAGGG + Exonic
1162139466 19:8577264-8577286 ATCTGGAAGAAGAAAGAGGAGGG - Intronic
1163276090 19:16285230-16285252 AAGAGGAAGAAGAAAGAGAAGGG + Intergenic
1163549435 19:17957346-17957368 AAAAGAAAGAAGAAAGAGGAAGG + Intronic
1164436057 19:28230515-28230537 CTGAGTCACAAGAAAGTGGCTGG + Intergenic
1166060517 19:40322629-40322651 CTAAGAAAGAGGGAAGAGGACGG + Intronic
1167206244 19:48104636-48104658 CTGAGTGAGATGAAAGAACAGGG - Exonic
1167244240 19:48364270-48364292 CTGAGTAGGCGGAAAGAGGGAGG + Intergenic
1167474543 19:49692144-49692166 CTGGGTATGAAGGAGGAGGAGGG + Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
925326927 2:3030084-3030106 CAGAGGGAGAAGAAAGAGGCAGG + Intergenic
926574461 2:14564705-14564727 CTCAAGAAGAAGAAACAGGAGGG + Intergenic
926829040 2:16940239-16940261 GTGAGAAAGAAGACAGAGAAGGG - Intergenic
927003577 2:18824777-18824799 CTGAGTAAATAGAAAAAGGGAGG + Intergenic
927438469 2:23090646-23090668 GAGAGAAAGAGGAAAGAGGAGGG + Intergenic
927918431 2:26951690-26951712 CTGAGTTAGAAAATAGAGGCTGG - Intergenic
928538484 2:32262361-32262383 AAGAGGAAGAAGATAGAGGAAGG + Intronic
928633314 2:33216329-33216351 CTGGGAAAGAAAAAAGGGGAGGG + Intronic
929235625 2:39602509-39602531 CTCAGTAATAAGAAGGAGCAAGG - Intergenic
929273529 2:40000394-40000416 CTGAATAAGATAAACGAGGAAGG - Intergenic
929350320 2:40943063-40943085 ATGGATAAGAAGAAAGTGGAAGG + Intergenic
929368326 2:41189323-41189345 ATGAGAAAGAAGAAAGAAAAAGG + Intergenic
929982727 2:46697104-46697126 GAGAGTAAGAAGAAAGCAGAAGG + Intergenic
930018219 2:46985191-46985213 CTCAGGAAGAAAGAAGAGGAAGG - Intronic
930215594 2:48693145-48693167 CTGAGCAAGAAGAGAGGGAAGGG + Intronic
930221346 2:48749645-48749667 CTTAGGAAGAAGATAGAGGTGGG + Intronic
931003515 2:57819599-57819621 TTGACTGAGAAGATAGAGGAAGG + Intergenic
931322377 2:61183554-61183576 TTGAGTAAAAAGAAAGGAGATGG + Intronic
931393517 2:61865272-61865294 CTGAGTAAGAAAAAGGTGGCTGG + Intergenic
932052429 2:68412022-68412044 CTGAGGGAGAAAAAAGAGGATGG + Intergenic
932385268 2:71326563-71326585 CAGAGGAAGAATGAAGAGGAAGG - Intronic
932592729 2:73076764-73076786 TTGGGTGAGAAGAAAGGGGAAGG - Intronic
932724199 2:74163979-74164001 CTGAAAAAGAAGAGCGAGGAAGG + Intronic
933158740 2:79001650-79001672 CAGAGGAGGAAGTAAGAGGAGGG + Intergenic
933377324 2:81496534-81496556 CTGAGGAAGAAAAGAGATGAAGG - Intergenic
933530628 2:83506061-83506083 CCGAGGAAGAAGATAGAGAAGGG - Intergenic
934874912 2:97908571-97908593 ATGAGCAAGGGGAAAGAGGAGGG + Intronic
935020214 2:99223065-99223087 CTGTGTAAGTAAAAATAGGATGG - Intronic
935620749 2:105127589-105127611 CTAAGTGAGGAAAAAGAGGAAGG - Intergenic
935733712 2:106089022-106089044 CATAGAAAGAAGAAAGAGGATGG - Intergenic
935813587 2:106825226-106825248 CTGAGAAAGAGCAAGGAGGAAGG - Intronic
935918962 2:107988621-107988643 CAGAGTAAAAACAAAGAGGTGGG + Intronic
936392680 2:112089582-112089604 CAGAGAAAGAAGAAAAAGCATGG - Intronic
936447524 2:112607408-112607430 CTCTGTCAAAAGAAAGAGGAAGG - Intergenic
936451373 2:112636217-112636239 ATGGGTAGGAAGAAAAAGGAAGG + Intergenic
936918099 2:117660774-117660796 CTGAGGAACAAGAAGGAGGCTGG - Intergenic
937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG + Intronic
937477362 2:122227445-122227467 CTGAGAAAGAAGACCCAGGAGGG + Intergenic
937656653 2:124384753-124384775 CAGAGGAAGAACAAAGCGGAGGG - Intronic
937689434 2:124738235-124738257 CAGAGTGAAAAGAAAGAGGGAGG - Intronic
937843859 2:126555674-126555696 TAGAGAAGGAAGAAAGAGGAAGG + Intergenic
938600903 2:132838066-132838088 GTGAATAAGTTGAAAGAGGAGGG - Intronic
938784561 2:134614024-134614046 CAGAGAAAGAAGAAAAAGGTAGG + Intronic
939076924 2:137614278-137614300 ATGAGAAAGAAGAATGGGGATGG - Intronic
939212457 2:139194201-139194223 CAGACTAAGAAGAAAGAAAATGG - Intergenic
939526354 2:143299890-143299912 TTGAGTAATATTAAAGAGGAAGG + Intronic
939797939 2:146670553-146670575 AAAAGTAAGAATAAAGAGGAAGG + Intergenic
939855385 2:147352758-147352780 CAGAGAGAGAAGAATGAGGAAGG + Intergenic
940164056 2:150748397-150748419 AAGAAAAAGAAGAAAGAGGAAGG - Intergenic
940210431 2:151251219-151251241 CTGAGTCAGGAGAAAGTGGATGG - Exonic
940344658 2:152616779-152616801 GAAAGTAAGGAGAAAGAGGAGGG - Intronic
940492004 2:154374514-154374536 TTGAGTAAGGAAAAAAAGGATGG + Intronic
940757426 2:157699228-157699250 CTGGGTCAGAAGAAGGAGCAGGG + Intergenic
940847476 2:158657178-158657200 CTGAGTAAGAGGAAAGTAGGTGG - Intronic
941396474 2:164980257-164980279 GTGGGGAAGAAGGAAGAGGAAGG - Intergenic
941595967 2:167477473-167477495 ATTAGACAGAAGAAAGAGGAAGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942117575 2:172743219-172743241 CTGAGGAAAGAGAAAGAGGATGG + Intronic
942196571 2:173526656-173526678 CTGAGCAAAAAGAAGGAGGCTGG - Intergenic
943046156 2:182864782-182864804 CTGCGCAAGTTGAAAGAGGAAGG + Intronic
943388394 2:187230628-187230650 CTAGATAAGAGGAAAGAGGAAGG + Intergenic
944280996 2:197897197-197897219 AAGAGGAAGAAGAAAGAAGAAGG - Intronic
944398935 2:199303381-199303403 CGGAGGAAGAAGGAAGATGAAGG + Intronic
945110990 2:206359481-206359503 CTGAGTAAAAAGAACAAAGATGG + Intergenic
945159384 2:206873692-206873714 CTGTTTAAAGAGAAAGAGGATGG + Intergenic
945347442 2:208734761-208734783 CTGAGCAAGAAGAAAAAAGCTGG - Intronic
945552312 2:211235595-211235617 ATAAGTAGGAAGACAGAGGAAGG - Intergenic
945768528 2:214010868-214010890 GTGAGTAAAAAGAAAGTGGGAGG + Intronic
946764145 2:223024434-223024456 AGGAGTCAGAAGAAAGAAGACGG + Intergenic
946932370 2:224683493-224683515 CTGACTTTGAAGATAGAGGAAGG + Intergenic
947072458 2:226305655-226305677 ATGTGTAACAAGAAAGAAGAGGG + Intergenic
947308515 2:228774576-228774598 TTGAGAAAGAAGAAAGAGCAGGG - Intergenic
947491495 2:230599289-230599311 TTGAGAAAGAAGAATGAAGATGG + Intergenic
948437674 2:237965270-237965292 TGGAGGAAGAAGGAAGAGGAGGG + Intergenic
948533180 2:238626523-238626545 CTGAGAAAGGAGAACAAGGAGGG - Intergenic
948564222 2:238873363-238873385 CTGAGAAGGAAGCAAGAGGATGG + Intronic
948623915 2:239255513-239255535 CTGTGTAAGAATAAAGACAAAGG - Intronic
948924084 2:241082681-241082703 CTGAGGAAGAGAAGAGAGGAAGG - Intronic
949025662 2:241766078-241766100 CTGAGTGAGTAGGAAGAGGGGGG + Intronic
1168854770 20:1001004-1001026 CTGAGCAAGGATAAAGGGGAAGG - Intronic
1169730293 20:8778545-8778567 CTTAGTGAGAAGGAAGTGGAAGG - Intronic
1169892338 20:10466665-10466687 ATGGGTGGGAAGAAAGAGGAGGG - Intronic
1169921837 20:10742751-10742773 CTGAAAAAGAAAAAAGAGAATGG - Intergenic
1169979708 20:11370712-11370734 ATGGGCAAGAAGAAAAAGGATGG + Intergenic
1170014001 20:11760191-11760213 CTGAGAAAGAACAAAGCTGAAGG - Intergenic
1170394227 20:15908655-15908677 CTGAGTAAGAAATAAAAGAAAGG - Intronic
1170421022 20:16193431-16193453 CAAAGTAAGAAGAAAGAAGGGGG + Intergenic
1170952792 20:20951901-20951923 CTGAGACAAAAGAAAGGGGATGG + Intergenic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171326734 20:24300910-24300932 CTGAGCTGGAAGAAGGAGGAGGG + Intergenic
1172208182 20:33179574-33179596 CGGAGAAAGGAGGAAGAGGAGGG - Intronic
1172437699 20:34941791-34941813 CTGAGTAAGACCAAAGAAGCTGG - Exonic
1173349406 20:42231295-42231317 CTTAGTAAGAAGAATGGGTAGGG + Intronic
1173767023 20:45621342-45621364 GGGATTAAGAAGAAAGTGGAAGG - Intronic
1174135954 20:48379629-48379651 CTGAGTCTGAAGACAGAAGAAGG - Intergenic
1174541681 20:51294647-51294669 CAGGGTTGGAAGAAAGAGGAAGG - Intergenic
1174556043 20:51396466-51396488 CTGAGAAAGCAGCAACAGGAAGG + Intronic
1174664560 20:52245844-52245866 CTGGGTAGGAAAAATGAGGATGG + Intergenic
1175055572 20:56194415-56194437 CTGAGAAAAAAGAAAAAAGAGGG - Intergenic
1175757400 20:61538488-61538510 CAGAGTAGGAGGAGAGAGGAGGG - Intronic
1175763339 20:61576011-61576033 CTGAGTAGGAGGAAAAGGGAGGG + Intronic
1177392349 21:20492553-20492575 CTGAGGAAGAAGAATGAAGTAGG - Intergenic
1177558540 21:22721039-22721061 CTGGGTTAGAAGAATAAGGATGG + Intergenic
1178264831 21:31133270-31133292 CAGAGTAATAGGAAAGAGAAGGG - Intronic
1179548909 21:42130912-42130934 CTGAGTAGGAAGCAGGAGAATGG - Intronic
1179769862 21:43606423-43606445 GTGAGCAGGAGGAAAGAGGAGGG + Intronic
1180592139 22:16949393-16949415 GTAAGTATGAACAAAGAGGAGGG + Intergenic
1180674574 22:17578410-17578432 TTGGGTAAGAAAAGAGAGGAGGG - Intronic
1181368460 22:22398139-22398161 CTAAGGAAGATGAAAAAGGAGGG + Intergenic
1182944608 22:34310262-34310284 CTGAGAAAGAAGAATGTGTATGG + Intergenic
1183291956 22:37008147-37008169 CTGTGTAGGAAAAAGGAGGAAGG + Intergenic
1183981848 22:41545246-41545268 CGGAAGAAGAAGAAAGAAGAAGG + Intergenic
1184846208 22:47089063-47089085 CAGAGAAGCAAGAAAGAGGAGGG + Intronic
1184930919 22:47680786-47680808 CTGAGAAAGCTTAAAGAGGAGGG + Intergenic
1185089395 22:48757297-48757319 AGGAGGAAGAGGAAAGAGGAGGG + Intronic
949828791 3:8191614-8191636 AAGAGGAAGAAGAAAGAAGAAGG - Intergenic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
950832084 3:15885040-15885062 GTGGGAAGGAAGAAAGAGGAAGG + Intergenic
951281278 3:20752912-20752934 CTGAGTACCTAGAAACAGGATGG - Intergenic
952064744 3:29555756-29555778 CTGAGTGAGAACAAAGTTGAGGG - Intronic
952164002 3:30725741-30725763 CAGAGTAAAAAGATAGAGCATGG - Intergenic
952219454 3:31310229-31310251 CAAAGTAAGAAGAAATAGGCTGG - Intergenic
952355301 3:32578516-32578538 CTAGGTGAGAAGCAAGAGGAAGG - Intergenic
952960439 3:38586042-38586064 CTGGGGAAGGAGGAAGAGGAGGG + Intronic
953006892 3:38987234-38987256 GGGAGGAAGAAGAAAGAGGAGGG - Intergenic
953160337 3:40413942-40413964 CTCAGGAAGAAGAAAGAGCAAGG - Intronic
953693105 3:45136378-45136400 CTAAGGAAGAAGGAGGAGGATGG + Intronic
953735036 3:45486408-45486430 CTGAGAATGAACAAAGAGAAGGG + Intronic
953977179 3:47390646-47390668 CTAAAAAAGAAGAAAGAGGCTGG - Intronic
954017919 3:47711335-47711357 CTGAGTAAGAATAAAATGAAAGG + Intronic
954042535 3:47899838-47899860 CTGAGTTTGAAGAAAGCGCATGG + Intronic
955352095 3:58201110-58201132 CTGAGAAACAGGAAAGAGGCGGG + Intronic
955510923 3:59679524-59679546 ATGAGTAAGAAGGAGGAGGGTGG + Intergenic
956030079 3:65028085-65028107 CTGAGTAAAAAGAAAGAGAAAGG + Intergenic
956460925 3:69471761-69471783 CTGAGTCAGAAGAGAGTGGATGG - Intronic
956524731 3:70145073-70145095 CTGGGTAAGAATGAAGAAGAAGG - Intergenic
956890348 3:73607133-73607155 CTGAGCTAGAAGAAAGCGGTTGG - Intronic
957144054 3:76398869-76398891 CTGAGTATGAAGATGGAAGAAGG + Intronic
957773941 3:84730781-84730803 CTGTGTGAGAAGAAAGAGGAAGG - Intergenic
957959243 3:87227707-87227729 GTGAGTCAGAAGCAAGAGGGAGG - Intronic
958603109 3:96324675-96324697 ATGAGTAAGAAGCAAGAATATGG + Intergenic
959714753 3:109420442-109420464 CTGAGGATGGAGAGAGAGGAAGG - Intergenic
960092686 3:113657526-113657548 CTGAGTTTGAAGAATTAGGAGGG + Exonic
960650968 3:119949515-119949537 CTGAGTAAGGAGAGAAAGGTGGG + Intronic
960745539 3:120883939-120883961 CCTATTAAGAAGAAAGAAGAGGG + Intergenic
960893394 3:122475922-122475944 CTGAGGAGGAGGGAAGAGGAAGG + Intronic
961351022 3:126302757-126302779 ATAAGTAAGAAGTAGGAGGATGG - Intergenic
961531896 3:127545030-127545052 CTGGGTGAGCAGGAAGAGGAAGG + Intergenic
961601251 3:128063902-128063924 CAGAGTAACAAGTGAGAGGAAGG - Intronic
961892503 3:130142144-130142166 ATGGGTAATAAGAAAAAGGATGG + Intergenic
961995739 3:131240181-131240203 CTGAGAAAGGAGCCAGAGGAAGG - Intronic
962018707 3:131473111-131473133 CTGAGTAAGAATAAAAAAGCTGG + Intronic
963723503 3:148892209-148892231 GAGAGTCAGAAGTAAGAGGAGGG - Intronic
964414673 3:156434793-156434815 CTGAGAAAGAAGAAGGAGTTGGG + Intronic
964633959 3:158841205-158841227 CTGAGAAAGCAGAAAGCAGATGG + Intergenic
964713338 3:159695513-159695535 CTCAGTGAGAAGAGAGATGAAGG - Intronic
964823657 3:160801901-160801923 AAAAGTAAGAAGAAACAGGAAGG - Intronic
965523456 3:169691868-169691890 GAGAGAAAGAACAAAGAGGAGGG + Intergenic
965588625 3:170341966-170341988 CTGAGTAACAGAAAAGAGAAAGG + Intergenic
965972115 3:174572123-174572145 ATAACTAAGAAGAAAGAAGAAGG - Intronic
966430409 3:179826245-179826267 CTGGGTAAGGAGGAAGAGAAAGG - Intronic
966521895 3:180882295-180882317 CGGAGGAAGAAGAAGGAAGAAGG - Intronic
966739985 3:183223615-183223637 AAGAGAAAGAGGAAAGAGGACGG + Intronic
966921934 3:184617991-184618013 CCAAATAAGAGGAAAGAGGAAGG - Intronic
967131141 3:186471750-186471772 CTAAGGGAGAAGAAAGAGAAAGG + Intergenic
967202893 3:187089601-187089623 CTGAGTAAAAAGAATGAAGCTGG - Intergenic
967390372 3:188948634-188948656 ACAAGAAAGAAGAAAGAGGAGGG - Intronic
967415625 3:189215058-189215080 CTGAGTAAGATTATAGAAGATGG + Intronic
967455523 3:189681789-189681811 GAGAGTCAGAAGTAAGAGGAGGG - Intronic
968075825 3:195815767-195815789 CTGTGTAAGAAGAAGGAGGCCGG - Intergenic
968075836 3:195815812-195815834 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075848 3:195815857-195815879 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075860 3:195815902-195815924 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075872 3:195815947-195815969 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075897 3:195816037-195816059 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075909 3:195816082-195816104 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075921 3:195816127-195816149 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075933 3:195816172-195816194 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075945 3:195816217-195816239 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076095 3:195816780-195816802 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076131 3:195816908-195816930 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076231 3:195817253-195817275 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076293 3:195817475-195817497 CTGTGTAAGGAGAACGAGGCCGG - Intergenic
968096473 3:195934131-195934153 AGGAGGAGGAAGAAAGAGGAAGG + Intergenic
968144815 3:196289123-196289145 GTGGCTGAGAAGAAAGAGGATGG + Intronic
968229319 3:196996055-196996077 CTGGGGAAGAGGAAAGAGCAGGG - Intronic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
968477743 4:820392-820414 CTGGGCAAGAAGAGAGAGGCAGG + Intronic
969032068 4:4223550-4223572 CTGAGTAGAAAAAAAGAAGAAGG + Intronic
969750263 4:9104998-9105020 ATGGGTAATAAGAAAAAGGACGG - Intergenic
970032223 4:11689240-11689262 CTGAGTGAAAAGAAAGTGGTTGG + Intergenic
970405533 4:15759596-15759618 ATGAGGAAGAAGAAAGGGGATGG - Intergenic
970586289 4:17517601-17517623 CTAAGAAGGAAGAAGGAGGAAGG - Intronic
970696734 4:18686604-18686626 ATAAGGAAGAAGAAAGAGGAGGG + Intergenic
970988994 4:22191337-22191359 CAGAGAAAGAGAAAAGAGGAGGG + Intergenic
971419801 4:26464912-26464934 CTGAGTAAGAAAGGAGGGGAGGG + Intergenic
971642707 4:29156449-29156471 CTGATTGAATAGAAAGAGGATGG + Intergenic
971764875 4:30817979-30818001 CTGAGTGAGAAGAATGTGGCAGG - Intronic
971806650 4:31367007-31367029 CTCTGTAAGATGAAGGAGGAAGG + Intergenic
973573365 4:52262382-52262404 ATGATTTAGAAGAAAGATGAAGG + Intergenic
974091573 4:57316644-57316666 CTGAGGAGGCAGAAAGAGGGGGG + Intergenic
974339676 4:60599312-60599334 CTTAGCAAGAAGAAAGATGGAGG - Intergenic
975411372 4:74054962-74054984 GTCAGTAAGGAGAAAGAGGTAGG + Intergenic
975465076 4:74699556-74699578 CTAGGCAAGAAGAAAAAGGAAGG - Intergenic
975660340 4:76682202-76682224 CTGACTGGGAAGAAAGATGAAGG + Intronic
975878934 4:78878699-78878721 TTGAGTAAGAAAAAAGAAGATGG - Intronic
975983265 4:80182885-80182907 CTGAGTAAGAAATAAAATGAGGG - Intergenic
976007387 4:80446110-80446132 ATGAGGAAGAAGAGAGAGGAAGG + Intronic
976052629 4:81027217-81027239 GGGAGTAATAAAAAAGAGGAAGG + Intergenic
976058097 4:81093018-81093040 CTGAGTAAGATGGAAAAGGTGGG - Intronic
976211213 4:82672307-82672329 CAGACTAAGAAAAAAGAGGTAGG + Intronic
976263802 4:83171473-83171495 CTGAGTAAAAAGAAAGATGGTGG - Intergenic
976886118 4:89986598-89986620 ATGAGTTTGGAGAAAGAGGAAGG - Intergenic
976960965 4:90972714-90972736 TTGAGTAAGAAGAAAGCTGGAGG + Intronic
977073171 4:92418618-92418640 ATGAGTAAAAAGATAGAGGCGGG + Intronic
977344607 4:95801769-95801791 CTGAGGAAGATAAAAGAGGCAGG - Intergenic
977540399 4:98312026-98312048 AGGAGGAAGAAGATAGAGGATGG + Intronic
977912992 4:102559149-102559171 AGGAGTAAGAAGAAAAAGGACGG + Intronic
978911612 4:114070315-114070337 CTGGGTAATAATAAAGAAGAAGG + Intergenic
979243518 4:118471456-118471478 CTGAGCAATATGAAAAAGGAAGG + Intergenic
979558945 4:122080470-122080492 AGGGGAAAGAAGAAAGAGGAGGG + Intergenic
980088735 4:128418979-128419001 CTGAGTAATAAGAAAAAATAAGG + Intergenic
980740009 4:136938293-136938315 CTGGGTAAGTGGAAAGAGAAGGG + Intergenic
980938934 4:139254178-139254200 CTGAGCAAGGAGACAGAAGATGG + Intergenic
981206454 4:142046594-142046616 TAGAGTGAAAAGAAAGAGGAGGG + Intronic
981216624 4:142177084-142177106 CTGAATTAGGAGAAAGAGGCAGG - Intronic
981249746 4:142585627-142585649 CTGAGAGCGAAGCAAGAGGAGGG - Intronic
981262629 4:142739958-142739980 CTGATTTAGCCGAAAGAGGATGG + Intronic
981780612 4:148425461-148425483 CTAAGTGACAAGAAAGAGGCAGG + Intronic
982455123 4:155600487-155600509 CTGAGTAACAGGAGAGATGATGG + Intergenic
982463930 4:155706515-155706537 CTGAAAAAAAAAAAAGAGGAGGG - Intronic
982465159 4:155721460-155721482 CAGAGGAAGCAGAAAGTGGAAGG - Intronic
982513390 4:156313266-156313288 CTGAGTAAGAGGAAAAATAAAGG + Intergenic
983328806 4:166296739-166296761 ATTAGTAAAAGGAAAGAGGATGG - Intergenic
983770127 4:171538892-171538914 CTGAGTATGACGCAAAAGGAAGG - Intergenic
984405311 4:179321548-179321570 CAGAGAAAAAAGAAAAAGGAAGG - Intergenic
984637979 4:182134416-182134438 CTGAGTTAGGGGAAAGAGAAGGG - Intergenic
984791318 4:183617390-183617412 TTGAAAAAAAAGAAAGAGGAAGG - Intergenic
984982359 4:185294869-185294891 CTGAGTTAAAAGAAAAAGTAAGG - Intronic
986141839 5:5038359-5038381 CTGAGTAAGACGATAGAGGAAGG + Intergenic
986532040 5:8747750-8747772 CAGAGAAAGAAGAGAAAGGATGG - Intergenic
987229859 5:15882534-15882556 CTGTGTAAGAAGAATGGGGAAGG - Intronic
987842668 5:23240491-23240513 CAGAGCAGGGAGAAAGAGGAGGG + Intergenic
988243461 5:28645072-28645094 CAGAAGAAGAAGAAAGAGAAAGG + Intergenic
988276655 5:29089664-29089686 AAGAGGAAGTAGAAAGAGGAGGG - Intergenic
988405076 5:30814042-30814064 CTCAGTAAGAAGAAATAAGTGGG - Intergenic
988782004 5:34530753-34530775 CTGAGAAGTAAGAAAGAAGATGG - Intergenic
988836906 5:35042363-35042385 GAAAGAAAGAAGAAAGAGGAAGG + Intronic
988893546 5:35647249-35647271 CTTAGTAAGGAGAAGGGGGAGGG + Intronic
989165601 5:38430954-38430976 CTGAACAAAAAGGAAGAGGAGGG - Intronic
989310404 5:40010524-40010546 ATGAGCTAGAATAAAGAGGATGG - Intergenic
989619573 5:43371062-43371084 CAGATTAAGAAAAAAGAAGAAGG - Intergenic
989681662 5:44036703-44036725 CTGATTAAGAAGATAAATGAAGG + Intergenic
990332336 5:54740278-54740300 CTGAGTGAGCAGAGAGATGAGGG - Intergenic
990772932 5:59270330-59270352 CTAAGATAGAAGAAATAGGAAGG + Intronic
990981452 5:61605863-61605885 CAGTGTAAGAATTAAGAGGATGG + Intergenic
991131696 5:63130199-63130221 CTGGGTAAGCAGATATAGGATGG - Intergenic
991368910 5:65897507-65897529 CTGAGGCAGAAGAATCAGGAGGG + Intergenic
991706446 5:69362887-69362909 CTCACTAATAACAAAGAGGATGG + Intronic
992133615 5:73720344-73720366 TTGAAAAAGAAGAAAAAGGAAGG + Intronic
992326223 5:75662922-75662944 CTGAGTAATAAGACAGAAAAGGG - Intronic
992673879 5:79085912-79085934 CAAAGTAAGAAGAAAGAGGATGG + Intronic
992751533 5:79867202-79867224 CTTAGCGTGAAGAAAGAGGAGGG - Intergenic
993070416 5:83155070-83155092 CTGGGGCAGGAGAAAGAGGAAGG + Intronic
993095028 5:83471666-83471688 CTCAGCGAGAAGAAGGAGGAGGG - Exonic
993274974 5:85845479-85845501 CTGACAAAGAAGAAAGAATAAGG - Intergenic
993819650 5:92599351-92599373 CTCAGTAAGAAGAAGGAACAGGG + Intergenic
993909307 5:93661905-93661927 CTGAGTGGGCAGAAAGAGTAAGG + Intronic
993933244 5:93968873-93968895 GTAAGCAAGAAGACAGAGGAGGG + Intronic
993958753 5:94270463-94270485 CTGAGCAAAAAGAACGATGAGGG + Intronic
994551801 5:101243208-101243230 CTAAGAAAGGAGAAAGAGAAGGG - Intergenic
994833273 5:104813584-104813606 CTGAGTAAGTTGGAAGAGGAAGG - Intergenic
995012297 5:107270719-107270741 TTAAGTCAGAAGAAAAAGGAGGG + Intergenic
996443606 5:123518746-123518768 CTGAGTTAGATGGAAGAGGGAGG + Intronic
996501395 5:124220560-124220582 AAGAAAAAGAAGAAAGAGGAGGG - Intergenic
996627328 5:125586105-125586127 CAGAGAAAGAGGGAAGAGGAGGG + Intergenic
996742038 5:126808572-126808594 AGGAGAAAGACGAAAGAGGAAGG + Intronic
996852805 5:127971521-127971543 TTTAATAAGAAGAAAGAGAAAGG - Intergenic
997378589 5:133418210-133418232 CTGATCAAGAAGAAAAAAGATGG + Intronic
997506599 5:134422729-134422751 TTGAGAAAGCAGCAAGAGGAAGG + Intergenic
997690655 5:135825633-135825655 CTGGGTATGAAGGAACAGGAAGG - Intergenic
997771750 5:136561486-136561508 CTGAGGAAGAAGACAGGGGCAGG - Intergenic
998172906 5:139882899-139882921 CTGAGGAACAAGAAAGAGGCAGG + Intronic
998263822 5:140651853-140651875 CTTAGTAGAAAGAAATAGGAAGG - Intronic
998411898 5:141917564-141917586 CTGTGTCAGAAGAAAAGGGATGG + Intergenic
998494462 5:142575498-142575520 CAGAGGAAGAGGAGAGAGGAGGG - Intergenic
999102270 5:149036492-149036514 GGGAGAAAGAAAAAAGAGGATGG - Intronic
999200442 5:149812641-149812663 CTGAGAAAGAAGCCAGAGCAGGG - Intronic
999950558 5:156645296-156645318 CTGAGAAAACAGAGAGAGGATGG + Intronic
1000254651 5:159526226-159526248 CTGAGGAAGTAGACAGAGCATGG - Intergenic
1000380373 5:160623555-160623577 CTTTGGAAGAAAAAAGAGGACGG + Intronic
1001265484 5:170271172-170271194 CAGAGAGAGAAGAAAGGGGAAGG + Intronic
1001295172 5:170494100-170494122 CTGAGTGAGGAGACTGAGGAAGG - Intronic
1001322450 5:170693804-170693826 ATTAGCAAGAAGAAAGTGGAGGG + Intronic
1001776150 5:174330599-174330621 AGAAATAAGAAGAAAGAGGACGG + Intergenic
1002184001 5:177445841-177445863 AAGAGAAAGAAGAAAGAGAAAGG - Intergenic
1002209050 5:177585099-177585121 CAGAGAAAGAAGGAGGAGGAAGG + Intergenic
1002761938 6:209185-209207 CCTAGGAAGAAGAAAGGGGAAGG + Intergenic
1002795100 6:465644-465666 AGGAGAAAGGAGAAAGAGGATGG - Intergenic
1002969138 6:1996155-1996177 ATGAGAAAGAGGAAGGAGGAAGG - Intronic
1003236222 6:4297431-4297453 CTGAGTAAGAAGAGAGAATGAGG + Intergenic
1003364539 6:5459791-5459813 CTAAGGAGGAAGAAATAGGAAGG - Intronic
1003499385 6:6691816-6691838 CTAAGTAGGAATACAGAGGAGGG - Intergenic
1003843560 6:10148418-10148440 CTTAGTAAGCAGAAACAGGTAGG - Intronic
1004368474 6:15031865-15031887 GAGAAGAAGAAGAAAGAGGAGGG + Intergenic
1004375222 6:15085300-15085322 CTGATTTTGAAGAATGAGGAAGG - Intergenic
1004571915 6:16854394-16854416 TTGAGTTAGGAGAATGAGGAAGG + Intergenic
1004691564 6:17996600-17996622 CAAAGTGAGAAGAAAGAAGAAGG + Intergenic
1004847490 6:19661588-19661610 ATGGGTTAGAGGAAAGAGGAAGG + Intergenic
1004989325 6:21119143-21119165 CTCAACAGGAAGAAAGAGGAAGG - Intronic
1005440117 6:25858290-25858312 AAGAATAAGAAGAAAGAGAATGG - Intronic
1005912931 6:30326785-30326807 CTGCGGAAGAAGGAGGAGGAGGG - Intronic
1006279099 6:33033002-33033024 TTGAGTAAGAAAAAAAAGAAAGG - Intergenic
1006447044 6:34085425-34085447 GTGAGTCAGTAGAGAGAGGAAGG + Intronic
1006590317 6:35150443-35150465 CTGATGAAGTACAAAGAGGAGGG - Intergenic
1006614320 6:35315391-35315413 CTGAGTAAAAAGAACGAAGCTGG - Intronic
1006635712 6:35459889-35459911 CTCATAAAGGAGAAAGAGGATGG - Intronic
1007866706 6:44978719-44978741 TTGAGTAAGAAGCAACATGAAGG + Intronic
1007876810 6:45112530-45112552 CTGATTAAGAATAGAGGGGAAGG + Intronic
1007938472 6:45754802-45754824 CTGAGAAAGAAGAGATAGGAAGG - Intergenic
1008265135 6:49415655-49415677 ATGAGAGAGTAGAAAGAGGAAGG + Intergenic
1008320767 6:50110814-50110836 CTCAGGAAAAAGAAAGATGAGGG - Intergenic
1008367849 6:50703774-50703796 TAGAGGAAGAAGAAAGAGGGAGG - Intergenic
1009334354 6:62467502-62467524 GTAAGAAAGAAGAAGGAGGAAGG + Intergenic
1009537336 6:64905380-64905402 CTGAGTAGGAATAAAGAACAGGG - Intronic
1010026758 6:71227501-71227523 CGAAGTAAGAAGAGAGAGCAGGG - Intergenic
1011349196 6:86403563-86403585 ATGAGTAAGAAGGAATATGATGG - Intergenic
1011617552 6:89211002-89211024 CAGAGAAATAAGAAAGAGAATGG + Intronic
1011746399 6:90411675-90411697 CTGAGTCAGAGGAAAGACCAAGG - Intergenic
1012090377 6:94886469-94886491 CTAATTAAGAAAAAAGAGAAAGG - Intergenic
1012378660 6:98592684-98592706 CTGAGGAAGAATAAAGATAAGGG + Intergenic
1013059070 6:106614263-106614285 CTGAGGAAGGTGAAAGAGCAGGG + Intronic
1013351705 6:109311802-109311824 GTGATGAAGCAGAAAGAGGAAGG - Intergenic
1013972687 6:116039805-116039827 GGGTGTAAGAAGGAAGAGGATGG - Intronic
1014024090 6:116624610-116624632 CTCAGAAAGTAGAAAGAGGCAGG + Intronic
1014153607 6:118086710-118086732 CTCAGTAAGAGGAAAGACCACGG - Intronic
1014725198 6:124963680-124963702 CTGTATAAGAAATAAGAGGAGGG - Intronic
1014749310 6:125237094-125237116 CAGAGTAAGAAGAAATGAGAGGG + Intronic
1014769011 6:125440079-125440101 CTGAGCAAGGAAATAGAGGAAGG - Intergenic
1014883765 6:126754951-126754973 CTGAACAAGAGGAAAGAGAATGG + Intergenic
1015441319 6:133250336-133250358 GTGAGTAAGTAGAAAGAATATGG + Intronic
1015497180 6:133893981-133894003 CTCTGTAAGATGAAAGAGGAAGG - Exonic
1015728614 6:136325074-136325096 GAGAGTGAGAAGGAAGAGGAAGG + Intergenic
1016133210 6:140503231-140503253 CAGAGTAAATAGAAAGAGGTGGG + Intergenic
1016229553 6:141786077-141786099 AAGAGAAGGAAGAAAGAGGAAGG - Intergenic
1016544139 6:145201704-145201726 CTGGGAAAGAAGAAAGAAGAAGG - Intergenic
1017049764 6:150379406-150379428 TTGAGGAATAAGAAAGAGGCTGG - Intronic
1017051913 6:150401380-150401402 CTGAGTAATGAAGAAGAGGAAGG + Exonic
1017338818 6:153295660-153295682 CTAAGTAAAAAGAAAACGGAAGG + Intergenic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1017800571 6:157892097-157892119 CTCAGTAGAAAGGAAGAGGAGGG + Intronic
1018322406 6:162625577-162625599 CAGAGTAGAAAAAAAGAGGAAGG - Intronic
1018546728 6:164945407-164945429 CAGAGTAAGAAGTAAGGTGAAGG + Intergenic
1018599035 6:165519011-165519033 TTGAATAAAAAGAAAGATGAGGG + Intronic
1018694331 6:166379731-166379753 CTGATGAAGTAAAAAGAGGAAGG + Intronic
1019102236 6:169640877-169640899 CTCACTAAGAAGGAAGAGCATGG - Intronic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019372663 7:671087-671109 CTGAGGAAGAAGGAGGTGGACGG - Intronic
1019484085 7:1280526-1280548 AGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1019551879 7:1607086-1607108 GAGAGAAAGAGGAAAGAGGAGGG - Intergenic
1019627980 7:2030903-2030925 ATGAGGAAGAACAGAGAGGATGG - Intronic
1019881416 7:3864705-3864727 CTTAGTAACGGGAAAGAGGAAGG + Intronic
1019969144 7:4526137-4526159 AAGAGGAAGAAGAAAGGGGAAGG + Intergenic
1020322714 7:6951647-6951669 ATGGGTAATAAGAAAAAGGACGG + Intergenic
1020405124 7:7824334-7824356 CTGAGGAAGAAGTAAAAGAAGGG - Intronic
1020425203 7:8057717-8057739 CAGATTAAGAAGAAAAAGGAAGG - Intronic
1021672661 7:23047525-23047547 AGGAGGAAGAAGAAAGAAGAAGG - Intergenic
1022037814 7:26550591-26550613 AGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1022270976 7:28807810-28807832 TTGAGAATGAAGAAGGAGGAAGG + Intronic
1023098215 7:36685195-36685217 CTAAGTGATAAGAAAAAGGAAGG + Intronic
1023115706 7:36859946-36859968 ATGAGGGAGAAGGAAGAGGACGG - Intronic
1023183933 7:37513972-37513994 ATGAGTTAGAAGAATGAGTAAGG - Intergenic
1023461983 7:40408408-40408430 CTAAGTAAGCAGAAAGCGGGAGG - Intronic
1023710443 7:42986896-42986918 CAGGATAGGAAGAAAGAGGAAGG + Intergenic
1023860892 7:44217252-44217274 CTCAGCAAAAAGAGAGAGGAGGG + Exonic
1023979548 7:45060235-45060257 CCAAGCAAGAAGAGAGAGGAGGG - Intronic
1024130130 7:46343052-46343074 CTGCTGAAGAAGAATGAGGAAGG - Intergenic
1024204502 7:47145413-47145435 CTGAGTAACATGAAAACGGAGGG - Intergenic
1024564992 7:50673573-50673595 CTGAGGATGAAGAAGGAGGGGGG - Intronic
1026158951 7:67852217-67852239 AAGAGAAAGGAGAAAGAGGAGGG + Intergenic
1026725934 7:72869928-72869950 CTGAGTCAAAAGAAAAACGAAGG - Intergenic
1027454816 7:78376289-78376311 CTGAGAAAGATGAAAGAGAGCGG - Intronic
1027746275 7:82078876-82078898 AAGAGGAAGAAGAAAGAGGGTGG + Intronic
1028082481 7:86595571-86595593 GTGAGTGAGAAGAGAGAGAAGGG - Intergenic
1028527661 7:91803210-91803232 CTGACTTTGAAGACAGAGGAAGG - Intronic
1028847792 7:95501789-95501811 ATGAGAAGGAAGAAAGAGGTAGG + Intronic
1028879084 7:95859475-95859497 CTGGGTAAGATGAATGTGGAAGG - Intronic
1029838108 7:103334462-103334484 CTGAGGCAGAAGAATGAGGCAGG + Intronic
1029919843 7:104251589-104251611 CTGAGGAAGAATGAAGAGGGAGG + Intergenic
1030000065 7:105050266-105050288 CCTAGTAGGAAGAAAGAGAAGGG - Intronic
1030812153 7:113987732-113987754 CTGAGTATAATGTAAGAGGATGG + Intronic
1030849376 7:114463851-114463873 CAGAGTAAGAAGAAAGAACAAGG + Intronic
1031041162 7:116839782-116839804 ATGAGGAAGAGGAAAGATGAGGG + Intronic
1031744936 7:125483636-125483658 GTGTGTAAGAAGACAGAGGAGGG + Intergenic
1031999729 7:128256993-128257015 CAGAGAAAGAAGAGACAGGAGGG + Exonic
1032108799 7:129057082-129057104 CAGTGTAAGAAGGGAGAGGATGG - Intergenic
1032167457 7:129556646-129556668 CTGATAAAGAAGAAAGGGGGTGG + Intergenic
1032205254 7:129858656-129858678 CTGGGTAACAAGAAAAATGAAGG + Intronic
1032696700 7:134342951-134342973 TTGATTAAGAAGAAAGAAGAAGG - Intergenic
1033532771 7:142282060-142282082 CTGGGTAACAAGAATGAGGCAGG - Intergenic
1033638905 7:143241606-143241628 CTGTGTAGGAAGTAAAAGGAAGG - Intergenic
1034953983 7:155321957-155321979 CAGAGTGAGAAGAATTAGGAGGG + Intergenic
1035280697 7:157776360-157776382 GTGAGGAAGAAGAGAGAGGAGGG - Intronic
1036039647 8:5060994-5061016 CTGAGCAAGGAGGAAGAGGAAGG - Intergenic
1036373341 8:8179332-8179354 ATGGGTAATAAGAAAAAGGACGG - Intergenic
1036649636 8:10634108-10634130 CTGAGTAAGAAGAGAAGTGATGG + Intronic
1036877567 8:12486309-12486331 ATGGGTAATAAGAAAAAGGACGG + Intergenic
1037143189 8:15541567-15541589 CAGACTAAGAATAAAGAGAAAGG - Intronic
1037286215 8:17303419-17303441 GTGAGTAGGAAGAAAGAGATGGG + Intronic
1037371107 8:18180000-18180022 CATAGTAAGAAGTCAGAGGAGGG + Intronic
1037563613 8:20097389-20097411 CTGAATAAGAAGAATAAGGAGGG - Intergenic
1038306051 8:26403348-26403370 CTGAATAAGAAGAAAGTTTAGGG + Intronic
1038375227 8:27033539-27033561 CTGGGTAAGAGGAAGCAGGATGG - Intergenic
1038770359 8:30473314-30473336 CTGAGTAAGAATCGAAAGGATGG - Intronic
1038787127 8:30628546-30628568 CAGAGTAAGAAGATTGAGAAAGG + Intronic
1039747784 8:40445633-40445655 TTAAGAAAAAAGAAAGAGGAAGG - Intergenic
1039805470 8:40994062-40994084 CTGAGAAAGTAGACAGAGAATGG - Intergenic
1040536059 8:48311458-48311480 TTGAGTAAGAAGAACAAGGCTGG + Intergenic
1040758805 8:50812959-50812981 CTATGTAAGAAAAACGAGGATGG - Intergenic
1041119784 8:54574449-54574471 TTGGGTAAGAAGAAAGGGGGTGG + Intergenic
1041478467 8:58292191-58292213 GTGCGTAAGAAGAAAATGGATGG - Intergenic
1042155877 8:65842758-65842780 CTGAGAAAGAAGTGAGAGTATGG + Intergenic
1042211954 8:66389851-66389873 TGGAGTCAGAAGAAAGATGAAGG - Intergenic
1042334117 8:67612480-67612502 TTGAGAAAGAAGAAAGGAGAAGG - Intronic
1042537255 8:69871170-69871192 AAGAGCAAGAAGAAAAAGGAAGG + Intergenic
1042659106 8:71134220-71134242 CTGAGTAACCAAACAGAGGATGG + Intergenic
1042745182 8:72099451-72099473 CTGGGCAACAAGAAAGAGGGAGG - Intronic
1042788724 8:72579813-72579835 CAGAATAAGAAGATAGAGTAAGG - Intronic
1042810878 8:72824066-72824088 CTGAGTGAGAAGAAAAATTATGG - Intronic
1043033204 8:75164844-75164866 ATGAGGAAGAAGAAAAAAGATGG + Intergenic
1043383063 8:79723354-79723376 CTGAGTAAGGGGAAATAGAAAGG + Intergenic
1043383092 8:79723484-79723506 GTGAGGAGGAAGAGAGAGGAAGG - Intergenic
1043503952 8:80884610-80884632 AGGAAGAAGAAGAAAGAGGAAGG + Intergenic
1043666999 8:82826711-82826733 CTGAGTCTGAAGACAGAAGAAGG + Intergenic
1043830079 8:84978077-84978099 CAGAGTTAGAAGAATGTGGAAGG + Intergenic
1043854194 8:85245772-85245794 CTGAGCAGCGAGAAAGAGGAGGG - Exonic
1043917368 8:85938490-85938512 CTGTTAAAGAAGAAAGAGGAAGG - Intergenic
1044315420 8:90745020-90745042 CTAAGCAAAAAGAAAGAGGCTGG - Intronic
1044731341 8:95230975-95230997 CTGAGAGAGAAGAATGAGGCAGG + Intergenic
1044750717 8:95412877-95412899 TTAAATGAGAAGAAAGAGGAGGG - Intergenic
1045076015 8:98569111-98569133 CTGAGCAAGGAAAAAGAGCAAGG + Intronic
1045301949 8:100918942-100918964 TAGAGGAGGAAGAAAGAGGAAGG + Exonic
1046898891 8:119502558-119502580 CTGAGCAGGATGAAAAAGGATGG - Intergenic
1046999294 8:120557500-120557522 CTGGGTAAGAAGATAGATGTTGG + Intronic
1047063966 8:121260027-121260049 CTGAGCAAGAAAAAAAGGGAAGG - Intergenic
1047167917 8:122461311-122461333 CTGAGTAAGAAGGAGGGGGCTGG + Intergenic
1047325796 8:123834713-123834735 GTGAGTGAGAGGACAGAGGATGG - Intergenic
1047539793 8:125753695-125753717 CTGAGTTAGATGATACAGGAGGG - Intergenic
1048114303 8:131504685-131504707 CTGAGTGAGATGATAGTGGAGGG - Intergenic
1048224017 8:132567548-132567570 ATGAGGCAGAAGGAAGAGGAAGG - Intergenic
1048919288 8:139213360-139213382 CTGAGAGAGAAGGAAGAGGAGGG - Intergenic
1049009029 8:139875154-139875176 CGGGGGAAGAAGAGAGAGGAGGG + Intronic
1049975786 9:860448-860470 CAGAGTAAGAAGAGTGAGGGAGG - Intronic
1050452509 9:5798153-5798175 CTGGATGAGAAGAAATAGGATGG - Intronic
1050640579 9:7663046-7663068 GGGAGTAAGAAGAAAAAGGAAGG - Intergenic
1050768322 9:9164270-9164292 CTGACTTTGAAGATAGAGGAAGG - Intronic
1051167624 9:14281308-14281330 CTGAGTCTGAAGAAAGTGAAAGG + Intronic
1051216452 9:14803195-14803217 AAGAGAAAGAAGAAAGAGGGAGG - Intronic
1051366355 9:16324150-16324172 CTGAGGAAAAAGGAAGGGGAGGG + Intergenic
1052167648 9:25352789-25352811 TTAAGGAAGAAGAGAGAGGAAGG - Intergenic
1052331570 9:27275202-27275224 CTTTGTAAGAAATAAGAGGAAGG + Intergenic
1052495745 9:29221291-29221313 CAGAGGAAGAAGAATGAAGAAGG + Intergenic
1053037513 9:34837948-34837970 CTGAGGATGAAGCAAGAGAAAGG + Intergenic
1053154227 9:35763961-35763983 TTGAGAAAGGAGAGAGAGGAGGG + Intergenic
1054757541 9:68974168-68974190 CTTAGCAAGAATGAAGAGGAAGG - Intronic
1055224432 9:73977188-73977210 CTACATAAGTAGAAAGAGGAAGG + Intergenic
1055335635 9:75230376-75230398 CTGAGCATGAAAAAAAAGGAAGG - Intergenic
1056508949 9:87284457-87284479 ATGAGTGAGAAGAAAGAGACAGG - Intergenic
1056947263 9:91009010-91009032 CTGAGTAAGAAGGCATAAGAAGG - Intergenic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1058157019 9:101527259-101527281 CTGACTCAGAAGAAAGAAAAAGG - Intronic
1058276811 9:103052995-103053017 AAGAGAAAGAAGAAAAAGGAAGG - Intergenic
1058671778 9:107366452-107366474 CAGAGTAAGAAGAACCAGGGAGG - Intergenic
1058942791 9:109829645-109829667 CTGATAAAGAAGAGAGAGAAAGG - Intronic
1058989732 9:110243231-110243253 CTGAGTAAGCAGGAAAATGATGG - Intergenic
1059351103 9:113665654-113665676 CTGAAGAAAAAGAGAGAGGATGG - Intergenic
1059354261 9:113687179-113687201 AGGAGGAGGAAGAAAGAGGAAGG + Intergenic
1059621782 9:116013677-116013699 CTGAGAAAGAAGGAAGAGTGAGG + Intergenic
1059929361 9:119245664-119245686 TTTAGGAAGAGGAAAGAGGAAGG - Intronic
1060203178 9:121664335-121664357 TTGAGAAAGAAGAAACAGGTTGG - Intronic
1060313990 9:122491398-122491420 CTGAGGAAAAAGAAGAAGGAGGG + Intergenic
1060424862 9:123495719-123495741 GGGAGTTAGAAGAAAAAGGATGG - Intronic
1060455434 9:123789666-123789688 AGAAGTAAGAAGAAAGGGGAGGG - Intronic
1060839410 9:126782020-126782042 CTGAGCAGGGAGAGAGAGGAGGG + Intergenic
1060881972 9:127123693-127123715 CAGAGTAAGAAAGGAGAGGATGG + Intronic
1061238345 9:129354728-129354750 CTCAGTAAAAATAAAGAGGCTGG + Intergenic
1061541617 9:131280532-131280554 CTGAAAAATGAGAAAGAGGAGGG + Intergenic
1061716240 9:132520133-132520155 CTGAGTGAGAGGAGAGGGGAGGG - Intronic
1062259827 9:135655992-135656014 CTGAGTCTGAGGACAGAGGAGGG - Intergenic
1062571458 9:137187643-137187665 CAGAGTAAGAGGAAGGGGGAAGG - Exonic
1186202518 X:7168737-7168759 CTGGGTAAGGACAGAGAGGAAGG - Intergenic
1186530291 X:10288360-10288382 AGGAGCAAGAAGAAAAAGGATGG - Intergenic
1186757289 X:12685352-12685374 ATGAGAGAGAAGAAAGAGGGAGG - Intronic
1186844580 X:13517962-13517984 CTGGGTATGGAGAAAGTGGAAGG - Intergenic
1186915037 X:14209684-14209706 GTCAGAGAGAAGAAAGAGGAAGG + Intergenic
1186976437 X:14911531-14911553 GTGTGTAAAAAGAAAGAGGAAGG + Intronic
1189051720 X:37652393-37652415 CTGAGTATGAAGAGACAAGAGGG - Intronic
1189054127 X:37680692-37680714 CTGAGGAAGAAGAGGGAGAAGGG + Intronic
1189060403 X:37747101-37747123 CTGATGAAGAAGAAAGAGAGGGG + Intronic
1189360697 X:40348579-40348601 CACAGTAAGAAGTAAGAAGATGG - Intergenic
1189512204 X:41674071-41674093 CAGAGGAGGAAGAAAGAGGAAGG + Intronic
1189624924 X:42886827-42886849 GTTAGAAAGAAGAGAGAGGAAGG + Intergenic
1189711434 X:43816741-43816763 CTGAGAGAGAAATAAGAGGAAGG + Intronic
1190146818 X:47900152-47900174 TTGAGGAAGAAGAAAAAGTACGG + Intronic
1190730027 X:53219797-53219819 CTGACTAATAAGAAGGAGCAGGG - Intronic
1190819278 X:53958400-53958422 CTGAGTTAAAAAAAAAAGGAGGG + Intronic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1191108379 X:56786596-56786618 AGGAGAAAGAAGAAGGAGGAGGG - Intergenic
1192143953 X:68668206-68668228 AAGAGAAAGAAGAAGGAGGAGGG - Intronic
1192530556 X:71879753-71879775 CTAAGTAAGAAGAAAGAAACTGG + Intergenic
1193103028 X:77637045-77637067 AGGAGGAAGAAGAAAGAAGAAGG + Intronic
1193384457 X:80854291-80854313 CTAAGAATGAAGAAAGAGGCTGG - Intergenic
1193423010 X:81307377-81307399 CTGAATGAGGAGAAAGAGTAAGG - Intergenic
1193535357 X:82709049-82709071 CTAAGTGAGAGGACAGAGGAAGG - Intergenic
1193845032 X:86458071-86458093 CTGATTGAGAAGAAACATGAAGG + Intronic
1193970439 X:88044474-88044496 CTGAGTAAAAAGAACAAAGATGG + Intergenic
1194640055 X:96392915-96392937 CTGAGTATGAAGCAGTAGGAGGG + Intergenic
1194709655 X:97219809-97219831 GTGAGTAAGATGAAAAATGAAGG - Intronic
1195680455 X:107542163-107542185 CTGAGGCAGAAGCAAGAGAAAGG - Intronic
1195920003 X:109974263-109974285 CTGAAAAAGTAGAAAGAAGATGG - Intergenic
1195923547 X:110003955-110003977 CTGAGGCAGACGAAGGAGGACGG + Exonic
1195957978 X:110354211-110354233 TTGAGTAAGAAGAACAAGGGTGG + Intronic
1196011647 X:110894427-110894449 CTGAAGAAGAAGAAAAAGGAAGG + Intergenic
1196421873 X:115530891-115530913 CATAGTAAGAAAAATGAGGAAGG + Intergenic
1196642230 X:118075484-118075506 CTAAGAAAAAAGAGAGAGGAAGG + Intronic
1197145398 X:123166732-123166754 CTCAGTTAAAAGAAAGTGGATGG + Intergenic
1197637579 X:128932371-128932393 CTCTGGAAGAAGAAAGAAGAGGG - Intergenic
1197868373 X:131042439-131042461 CAGAGTCTGGAGAAAGAGGATGG + Intergenic
1198080616 X:133235957-133235979 CAGAGCAACAGGAAAGAGGAAGG - Intergenic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1199860428 X:151796432-151796454 GTGAAGAAGAGGAAAGAGGAAGG - Intergenic
1200085103 X:153600169-153600191 CTGAGGAAGGAGAATGAGGCCGG - Intergenic
1200686456 Y:6263948-6263970 CAGATCAAGGAGAAAGAGGATGG + Intergenic
1200691282 Y:6307670-6307692 ATCAAGAAGAAGAAAGAGGATGG - Intergenic
1200989330 Y:9334865-9334887 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1200991999 Y:9355195-9355217 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1200994653 Y:9375475-9375497 CGGATCAAGGAGAAAGAGGATGG + Intronic
1200997316 Y:9395821-9395843 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1200999831 Y:9464358-9464380 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1201002489 Y:9484667-9484689 CGGATCAAGGAGAAAGAGGATGG + Intronic
1201005149 Y:9504954-9504976 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1201007807 Y:9525281-9525303 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1201010424 Y:9545471-9545493 CTGATCAAGGAGAAAGAGGAGGG + Intergenic
1201043990 Y:9867046-9867068 ATCAAGAAGAAGAAAGAGGATGG + Intergenic
1201345403 Y:12978293-12978315 CTGAGAAAGAACAAAGCTGATGG + Intergenic
1201683497 Y:16675788-16675810 CTGAGAATGGAGAAAGAGAATGG + Intergenic
1201724176 Y:17135510-17135532 GAGAGTAAAAAGAGAGAGGAAGG + Intergenic
1202114668 Y:21459845-21459867 CTGACTCAGCAGAAATAGGAGGG + Intergenic