ID: 904760924

View in Genome Browser
Species Human (GRCh38)
Location 1:32804267-32804289
Sequence CGGGGTGGCCGCCGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5269
Summary {0: 5, 1: 305, 2: 1494, 3: 1847, 4: 1618}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904760913_904760924 12 Left 904760913 1:32804232-32804254 CCGTTCTCAACGAGCTGTTGGGT 0: 10
1: 1054
2: 706
3: 150
4: 138
Right 904760924 1:32804267-32804289 CGGGGTGGCCGCCGGGCAGAGGG 0: 5
1: 305
2: 1494
3: 1847
4: 1618
904760911_904760924 13 Left 904760911 1:32804231-32804253 CCCGTTCTCAACGAGCTGTTGGG 0: 10
1: 1406
2: 560
3: 137
4: 107
Right 904760924 1:32804267-32804289 CGGGGTGGCCGCCGGGCAGAGGG 0: 5
1: 305
2: 1494
3: 1847
4: 1618
904760909_904760924 28 Left 904760909 1:32804216-32804238 CCATCGTCATCATGGCCCGTTCT 0: 414
1: 1018
2: 754
3: 186
4: 228
Right 904760924 1:32804267-32804289 CGGGGTGGCCGCCGGGCAGAGGG 0: 5
1: 305
2: 1494
3: 1847
4: 1618

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904760924 Original CRISPR CGGGGTGGCCGCCGGGCAGA GGG Intronic
Too many off-targets to display for this crispr