ID: 904762954

View in Genome Browser
Species Human (GRCh38)
Location 1:32818215-32818237
Sequence CCCGCTTTCCGCCGGGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 90}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904762947_904762954 16 Left 904762947 1:32818176-32818198 CCCTACTGGGGGAGGGGCGGGGA 0: 1
1: 0
2: 0
3: 36
4: 303
Right 904762954 1:32818215-32818237 CCCGCTTTCCGCCGGGAGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 90
904762945_904762954 17 Left 904762945 1:32818175-32818197 CCCCTACTGGGGGAGGGGCGGGG 0: 1
1: 0
2: 3
3: 45
4: 422
Right 904762954 1:32818215-32818237 CCCGCTTTCCGCCGGGAGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 90
904762948_904762954 15 Left 904762948 1:32818177-32818199 CCTACTGGGGGAGGGGCGGGGAG 0: 1
1: 1
2: 6
3: 66
4: 516
Right 904762954 1:32818215-32818237 CCCGCTTTCCGCCGGGAGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904762954 Original CRISPR CCCGCTTTCCGCCGGGAGGC GGG Intronic
900102142 1:966456-966478 CCCGCCTCCCGCGGGCAGGCGGG - Intergenic
900102143 1:966456-966478 CCCGCCTGCCCGCGGGAGGCGGG + Intergenic
903550072 1:24151807-24151829 CCCTCTTTCCGCCGAAAGGCAGG - Intergenic
904762954 1:32818215-32818237 CCCGCTTTCCGCCGGGAGGCGGG + Intronic
904775055 1:32901359-32901381 CCCACTTCCCGCCCGGAGCCCGG + Intronic
921944733 1:220878996-220879018 TCCGCTCTCCACCGGGAGGCGGG + Intergenic
922742685 1:228023036-228023058 CCCGCTTACCTCCAGGAGGACGG + Intronic
922783280 1:228269870-228269892 CCCCTTTGCCGGCGGGAGGCCGG + Intronic
923612021 1:235504281-235504303 CTCCCTCTCCGCCGGGACGCGGG - Exonic
924539631 1:244969856-244969878 GCCGCTTCCCGGCGGGAGGCGGG + Exonic
1077368058 11:2169229-2169251 CCCACTGTGCCCCGGGAGGCAGG - Intronic
1078210249 11:9264862-9264884 CCCGCTTTGTCCCGGGAGCCGGG - Intronic
1088653463 11:111977600-111977622 CCCGCTTTCTCCCGCGAGCCGGG + Intronic
1090075633 11:123578567-123578589 CCCACTGTCCCCCGGCAGGCTGG + Intronic
1091222328 11:133936767-133936789 CCCGAGTTCCTCCAGGAGGCAGG + Intronic
1092242151 12:6841631-6841653 CCCCCTGTCCCCCGGAAGGCAGG + Intronic
1101604769 12:106239720-106239742 CCGGATCTCCTCCGGGAGGCGGG + Exonic
1119438327 14:74612091-74612113 CCCTCGTTCCGCCGAGAGCCGGG - Exonic
1119543143 14:75453463-75453485 GCCGCATTCTGCCCGGAGGCAGG + Intronic
1119731911 14:76956531-76956553 CCGGCTTCCTGCAGGGAGGCGGG - Intergenic
1119758314 14:77134020-77134042 CAGGCTTTCCACCGGGAGGGAGG + Intronic
1120832166 14:89007246-89007268 CCCACTTCCAGCTGGGAGGCTGG + Intergenic
1132475933 16:138261-138283 CCCGCATCCCGCCGTGGGGCCGG + Exonic
1134043240 16:11083788-11083810 TCCCCTGTCCGCTGGGAGGCAGG + Intronic
1135929973 16:26728071-26728093 CCCGCTTTCCCTGGGGAAGCAGG + Intergenic
1136179191 16:28539195-28539217 CCTGCTTTCTGCCGAGAAGCGGG - Intergenic
1142482370 17:227045-227067 CCCGGGTGCCGCCGAGAGGCAGG + Intronic
1143299866 17:5901355-5901377 CCAGCTTTCCTCCAGGAGGCTGG - Intronic
1146894882 17:36534280-36534302 CCCGGTTCCCGCCGGGAACCTGG - Intronic
1151554550 17:74840072-74840094 CCAGCTTTCTGCAGGGAGCCAGG - Intergenic
1151601691 17:75109948-75109970 CGCGGCTTCCGCCGGGAGCCCGG + Intronic
1151605136 17:75131119-75131141 CGCGGTTACCGCCGGGAGCCAGG + Intronic
1152449285 17:80366139-80366161 CCTGCCTTCCGCCGTGAGGCTGG + Intronic
1157464301 18:47930795-47930817 CCCGCCAGCCGCCGGGAGGTGGG - Intronic
1160144224 18:76350566-76350588 GCCGCTTCCCTCCGGGTGGCAGG + Intergenic
1160515726 18:79478326-79478348 CCAGCTGTCCCCCGGGAGCCAGG + Intronic
1160535159 18:79587649-79587671 CCTGCTCTCAGCCTGGAGGCTGG + Intergenic
1160803858 19:982876-982898 CCCGCTGGCCGCCAGGTGGCAGG - Intergenic
1160919221 19:1512075-1512097 CCCTCTTTCCCCCTGCAGGCTGG - Intronic
1161055655 19:2189560-2189582 CTCGCTTTCCGCCCTGATGCAGG - Intronic
1163597924 19:18231322-18231344 CCCGCTTGGCTCTGGGAGGCAGG - Intronic
1164065336 19:21709728-21709750 CCCTCTTTCTGCCGGCAGGGCGG - Intergenic
1167595814 19:50427587-50427609 CCCGCTTTGGGCTGAGAGGCTGG + Intronic
1168330388 19:55564462-55564484 CCCGCTTGCCCCAGGGAGGCCGG + Intergenic
928927937 2:36597765-36597787 CCCTCCTTCCGCCCGGACGCGGG - Intronic
933847573 2:86337787-86337809 CCCGCCTTCAGCCGGGGGCCAGG - Intronic
937470389 2:122169365-122169387 CCTGCTTTCCTCCTGGAGTCTGG + Intergenic
938069190 2:128299655-128299677 CCAGCTTTCTGCCGGGGGCCTGG - Intronic
941096646 2:161245055-161245077 CCCCTTTGCCGGCGGGAGGCCGG + Intergenic
944848196 2:203690194-203690216 CTTGCTTTCTGCAGGGAGGCAGG - Intergenic
947084228 2:226432822-226432844 CACACTTTCAGCTGGGAGGCAGG + Intergenic
948504972 2:238422508-238422530 CCCGCTTTCCGCCCCGCAGCTGG - Intergenic
948810364 2:240472193-240472215 CCAGCTGTACGCTGGGAGGCAGG + Intergenic
1171173267 20:23034109-23034131 TCAGCTTTCCGCTGGGTGGCTGG - Intergenic
1171858969 20:30377167-30377189 CCAGGTTTCTGCCGGGAGGGGGG - Exonic
1173911244 20:46672575-46672597 CACCCTTTCCACTGGGAGGCAGG + Intronic
1175907329 20:62387253-62387275 GCCGGTTTGCGCCGGGAGCCGGG + Intronic
1176234303 20:64047226-64047248 CCCCCTTTCCTGAGGGAGGCTGG - Intronic
1183872273 22:40748854-40748876 CCCGTTTGCCACTGGGAGGCAGG + Intergenic
1184091771 22:42296626-42296648 CGAGCTGTCAGCCGGGAGGCAGG + Intronic
1184106348 22:42369350-42369372 CCCGGTTTCCGCGGGGAGGGCGG - Intergenic
1184124815 22:42479644-42479666 CCCTCATTCCGCCCTGAGGCTGG + Intergenic
958731967 3:97969595-97969617 CCTGCTTTCCTCTGGGAGTCTGG + Intronic
960848021 3:122022320-122022342 GCCGCAGTCCCCCGGGAGGCGGG - Intergenic
965216920 3:165875069-165875091 CCCGCTCTCCGCCTGGAAACAGG - Intergenic
965590616 3:170357572-170357594 CTCGCTCTCCCCCGGGCGGCCGG + Intergenic
968228770 3:196992173-196992195 CCCGCTCTCCGCCGGGCGAGTGG - Intronic
968272986 3:197418993-197419015 CTCCCTTTCCACCGGGAGGCTGG - Intergenic
968551417 4:1225607-1225629 CCCGGTGTCCTCCCGGAGGCTGG - Intronic
969849166 4:9943090-9943112 CCAGCTGCCCGCTGGGAGGCAGG + Intronic
976812539 4:89111761-89111783 CCCGGATTCCGCCTGGACGCCGG - Intergenic
980130259 4:128811247-128811269 CCCGCCTTCGGGCAGGAGGCGGG + Intronic
985639305 5:1056150-1056172 ACCCCTCTCCGCCTGGAGGCTGG + Intronic
985808890 5:2068749-2068771 CCGGCTTTCCCCCCGCAGGCCGG - Intergenic
991975394 5:72179548-72179570 CCAGCTTTCCTGCGGCAGGCGGG - Intronic
994699878 5:103120401-103120423 CCCCCTTTCATCCCGGAGGCAGG - Exonic
997474261 5:134133601-134133623 CCCGCTTTGCGCCCGGTGGTAGG - Intronic
1002211059 5:177599822-177599844 TCCTCTTTCCGAGGGGAGGCGGG - Intergenic
1006818865 6:36874621-36874643 GGCGCGTTCCTCCGGGAGGCCGG - Intronic
1017446252 6:154509959-154509981 ACCGCTTCTCGCCGGGAGGAAGG + Intronic
1019337918 7:494018-494040 CCCCCTAGCCGTCGGGAGGCGGG - Intergenic
1019350742 7:552827-552849 TCCCCTTTCCCCGGGGAGGCCGG - Intronic
1019562312 7:1665112-1665134 CCGCCTTTCGGCCGGGAGGAGGG - Intergenic
1020773395 7:12424124-12424146 CCAGCTTTCTGCTGGCAGGCAGG - Intergenic
1024457532 7:49626466-49626488 CACGTTTTCCGCTGGGAGCCGGG - Intergenic
1025095577 7:56093065-56093087 CCCACCTTCCGCCCGGAGACTGG - Intergenic
1027219286 7:76203766-76203788 CGCGCTGTCCTCCTGGAGGCAGG + Intronic
1028476959 7:91264312-91264334 CTCCCTTTGCGCCGGGAAGCCGG + Intergenic
1032793463 7:135259281-135259303 CCCTCTTTCTCCCGGGAGGTCGG - Intergenic
1036644415 8:10602740-10602762 CCCGCTTTCCTCTGGGAGCTTGG + Intergenic
1037811404 8:22089217-22089239 GCCGCTTTCGCCCGGGAGCCGGG + Exonic
1037947620 8:22999286-22999308 TCCCCTTTCCTTCGGGAGGCGGG - Intronic
1040985271 8:53286953-53286975 CCCGCTCTGCGCAGGAAGGCTGG - Intergenic
1046962557 8:120125963-120125985 ACCTCTCTGCGCCGGGAGGCTGG + Intronic
1047097425 8:121640058-121640080 CCCGCCGGCCGCCCGGAGGCAGG - Intronic
1049689076 8:143950935-143950957 CCCGCCTTCCTCCAGGACGCCGG + Intronic
1062029012 9:134353651-134353673 CCTGCTTTCCCCAGGGTGGCAGG + Intronic
1062417190 9:136457543-136457565 CCCCATTTCCGCCAGGCGGCAGG + Exonic
1185581162 X:1212581-1212603 CCGTCTTTCTGCTGGGAGGCTGG - Exonic