ID: 904764405

View in Genome Browser
Species Human (GRCh38)
Location 1:32832573-32832595
Sequence ATGTAGGAATACTGGGCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 122}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904764405_904764415 20 Left 904764405 1:32832573-32832595 CCCATTGCCCAGTATTCCTACAT 0: 1
1: 0
2: 1
3: 7
4: 122
Right 904764415 1:32832616-32832638 TATACCTTATTGCAAGGGCGGGG 0: 1
1: 0
2: 0
3: 12
4: 93
904764405_904764418 24 Left 904764405 1:32832573-32832595 CCCATTGCCCAGTATTCCTACAT 0: 1
1: 0
2: 1
3: 7
4: 122
Right 904764418 1:32832620-32832642 CCTTATTGCAAGGGCGGGGGTGG 0: 1
1: 0
2: 2
3: 20
4: 142
904764405_904764413 18 Left 904764405 1:32832573-32832595 CCCATTGCCCAGTATTCCTACAT 0: 1
1: 0
2: 1
3: 7
4: 122
Right 904764413 1:32832614-32832636 TATATACCTTATTGCAAGGGCGG 0: 1
1: 0
2: 0
3: 16
4: 115
904764405_904764411 14 Left 904764405 1:32832573-32832595 CCCATTGCCCAGTATTCCTACAT 0: 1
1: 0
2: 1
3: 7
4: 122
Right 904764411 1:32832610-32832632 TTTGTATATACCTTATTGCAAGG 0: 1
1: 0
2: 0
3: 14
4: 186
904764405_904764414 19 Left 904764405 1:32832573-32832595 CCCATTGCCCAGTATTCCTACAT 0: 1
1: 0
2: 1
3: 7
4: 122
Right 904764414 1:32832615-32832637 ATATACCTTATTGCAAGGGCGGG 0: 1
1: 0
2: 3
3: 13
4: 122
904764405_904764412 15 Left 904764405 1:32832573-32832595 CCCATTGCCCAGTATTCCTACAT 0: 1
1: 0
2: 1
3: 7
4: 122
Right 904764412 1:32832611-32832633 TTGTATATACCTTATTGCAAGGG 0: 1
1: 0
2: 1
3: 19
4: 160
904764405_904764416 21 Left 904764405 1:32832573-32832595 CCCATTGCCCAGTATTCCTACAT 0: 1
1: 0
2: 1
3: 7
4: 122
Right 904764416 1:32832617-32832639 ATACCTTATTGCAAGGGCGGGGG 0: 1
1: 0
2: 1
3: 34
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904764405 Original CRISPR ATGTAGGAATACTGGGCAAT GGG (reversed) Intronic
901010198 1:6196718-6196740 ATAGAGGAATATTGGGGAATGGG + Intronic
902918236 1:19651516-19651538 ATGGAGGCTTACTGGGAAATGGG - Intronic
904764405 1:32832573-32832595 ATGTAGGAATACTGGGCAATGGG - Intronic
905554028 1:38867823-38867845 AAGCAGGAATACTGGATAATGGG + Intronic
906665681 1:47620245-47620267 ATGCAGGAAGACTGGGGAGTAGG + Intergenic
907719096 1:56954701-56954723 ATGGACCAATACTGGGGAATTGG - Exonic
910368839 1:86494585-86494607 ATGTAGGAATTGTGGGGAAATGG - Intronic
912163939 1:107020027-107020049 ATGTTAGAATAATGGGCAAGAGG - Intergenic
916028570 1:160856525-160856547 AGGTAGGAACACTGGGGAACTGG - Intronic
916208978 1:162343159-162343181 ATGGTGGAATACTGGGAACTAGG + Intronic
916445279 1:164866355-164866377 ATGGAGAAATTCTAGGCAATAGG - Intronic
917385123 1:174464371-174464393 ATTTTGGAATACTTGGCAAAAGG - Intronic
920802920 1:209206402-209206424 ATATAAGAAAACTGGGCACTGGG + Intergenic
1063312643 10:4968997-4969019 ATGAATGGATACTTGGCAATAGG - Intronic
1063315292 10:4998550-4998572 ATGAATGGATACTTGGCAATAGG + Intronic
1067342410 10:45416637-45416659 ATGGAGGAATACTGGACAGATGG + Intronic
1067473430 10:46551653-46551675 ATGCAGGTACACTGGGCAAGAGG - Intronic
1068933325 10:62613153-62613175 AAGTAGAAATTCTGGGCAAAAGG - Intronic
1069282691 10:66675296-66675318 ATGTAGTAATACTAGAAAATAGG - Intronic
1070861622 10:79670998-79671020 TTCTAAGAATACTGGGCTATTGG - Intergenic
1070875626 10:79804598-79804620 TTCTAAGAATACTGGGCTATTGG + Intergenic
1071642554 10:87326743-87326765 TTCTAAGAATACTGGGCTATTGG + Intergenic
1072539398 10:96386841-96386863 GTGTAGGAACGATGGGCAATGGG - Intronic
1072558250 10:96542279-96542301 ATGAAGGAATACTGGGGGAAGGG - Intronic
1075582248 10:123629701-123629723 ATGTGGAAATAATGGACAATCGG - Intergenic
1075669755 10:124256336-124256358 ATGTGAGAAAACTGGGCTATGGG - Intergenic
1085956605 11:81405383-81405405 ATGCAGCAATACTGGGAGATGGG + Intergenic
1086299199 11:85407076-85407098 ATCTAGGCATACTGGTCATTGGG - Intronic
1086418765 11:86616958-86616980 ATGTGGGAAAACTGGGTAAGGGG + Intronic
1087384461 11:97453011-97453033 ATGTAGAAATAATGGGGATTTGG + Intergenic
1087384860 11:97457995-97458017 ATGTAGAAATAATGGGGATTTGG - Intergenic
1089482802 11:118820726-118820748 ATGCAGGAATATTGGGGAAGAGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1092520233 12:9264437-9264459 ACGCAGGAATACTGAGGAATTGG + Intergenic
1098324695 12:69289530-69289552 ATGAAAGAAGACTGGGGAATGGG + Intergenic
1099291680 12:80783607-80783629 ATGGAGAGATAATGGGCAATGGG + Intergenic
1101308190 12:103552606-103552628 AGGTAGAAATACTGGGTATTTGG + Intergenic
1102662536 12:114542257-114542279 ATGTTGGTAAACTGTGCAATAGG + Intergenic
1105777183 13:23674112-23674134 ATGTGTTAATTCTGGGCAATGGG - Intronic
1108130969 13:47300108-47300130 AAGTAGGAATAGTGGACAAGTGG + Intergenic
1108539504 13:51426232-51426254 ATGTAGGAATACTGTTCTCTGGG - Intronic
1111885166 13:94011531-94011553 AAGTAGGATTACTGGGCATGTGG - Intronic
1117003287 14:51393551-51393573 CTGTGGGAATGCTGGGCCATGGG - Intergenic
1118385474 14:65252306-65252328 AAGTAGGAATTATGGGCATTTGG + Intergenic
1118546288 14:66893190-66893212 AAATAGGAACTCTGGGCAATAGG + Intronic
1124790767 15:32724381-32724403 ATGGAGGAAGACTGGGGCATAGG + Intronic
1126499654 15:49331187-49331209 ATGTCTGAATGCTGGACAATTGG - Intronic
1127102799 15:55584521-55584543 TTCTAGGAATACTGGAGAATGGG + Intronic
1127927481 15:63560982-63561004 ATGTCAGAATAATGGGCAGTAGG + Intronic
1128457460 15:67840267-67840289 ATGAAGGAATCATGGGAAATAGG + Intergenic
1128537803 15:68503879-68503901 ATGGAGGAAGACTGGGCAACTGG + Intergenic
1138120516 16:54397525-54397547 ATGCAGGAGAACTGGGCACTCGG - Intergenic
1145100972 17:20076699-20076721 ATGTGGGATTACTGGGTAAAAGG + Intronic
1145407947 17:22624708-22624730 TTCTAAGAATACTGGGCTATTGG + Intergenic
1148293850 17:46482164-46482186 AGGTAGGAATAATTGACAATTGG + Intergenic
1148316033 17:46699867-46699889 AGGTAGGAATAATTGACAATTGG + Intronic
1148632422 17:49121562-49121584 AGGTGGGTATACTGGGCACTGGG + Intergenic
1152824706 17:82457519-82457541 AGTAAGGAATACTGGTCAATTGG + Intergenic
1155549733 18:26952344-26952366 AGGTAGGACTCCTGGGCAATTGG + Intronic
1156006616 18:32450003-32450025 ATGTAAGAACACTAGCCAATGGG + Intronic
1156058542 18:33042939-33042961 ATGTAGGACAACTGAGCATTGGG + Intronic
1159123685 18:64198679-64198701 ATGTATAAATACTGTGGAATTGG + Intergenic
1167652816 19:50742342-50742364 ATGTTGGAGAACTGGGAAATTGG - Intergenic
1167819724 19:51916486-51916508 ATTTAGGAATACTTGAAAATAGG + Intronic
925545214 2:5008674-5008696 ATGTAGGAACATAAGGCAATTGG + Intergenic
926526580 2:13989297-13989319 ATGCAGGACAACTGGCCAATGGG + Intergenic
927941100 2:27103276-27103298 ATTTATAAATACTGTGCAATGGG - Intronic
928021800 2:27711222-27711244 ATGTAGCAATACTGGGCAAGGGG - Intronic
930758701 2:55007193-55007215 AGGAAGGAATACTTGGCATTTGG - Intronic
931090410 2:58879953-58879975 ATGCAAGAATACTGGGAAAGGGG + Intergenic
934771422 2:96910035-96910057 ATGTAGGTTTCCTGGGCATTTGG - Intronic
934979452 2:98827907-98827929 GTGATGGAATACTGGGCAGTGGG - Intronic
936937773 2:117854590-117854612 ATGGAGGAATACTTGGCGAGAGG - Intergenic
944331389 2:198470652-198470674 ATAGAGGAATAGTGGGCTATAGG + Intronic
945152540 2:206806293-206806315 AGGTAGAAATACTCTGCAATCGG + Intergenic
1169754596 20:9030415-9030437 ATGTAGGATTACTGCTGAATGGG + Intergenic
1175500499 20:59446749-59446771 ATGTTGGTGAACTGGGCAATTGG - Intergenic
1177621899 21:23606419-23606441 GTTTAGGAATACTGGGCTGTAGG - Intergenic
1178953444 21:37004361-37004383 ATGAAAGAACACTGGGCAACTGG - Intergenic
1179662933 21:42889697-42889719 ATGTAGTAATTCTGGGTAAAAGG - Intronic
1181402368 22:22658306-22658328 CTGTAGGTATTTTGGGCAATTGG - Intergenic
1181696430 22:24595004-24595026 ATGTGAGAATACTGGGCAGGGGG + Intronic
1181798819 22:25330537-25330559 CGGTAGGAATTTTGGGCAATGGG - Intergenic
957277096 3:78104630-78104652 ATGTAGAATTGCTGGGCTATGGG + Intergenic
957652422 3:83024961-83024983 TTTTAGTAATACTAGGCAATAGG - Intergenic
959134258 3:102397243-102397265 ATGTAAGAATGCTGTGCAATGGG + Intronic
960403809 3:117235531-117235553 AAGTATGCATAATGGGCAATTGG + Intergenic
960979532 3:123209795-123209817 ATCAAGTAAAACTGGGCAATGGG + Intronic
964518343 3:157537202-157537224 AAGTAGAAATACTGGGCCATGGG - Intergenic
972084388 4:35195976-35195998 ATGAAGAAATAATTGGCAATTGG - Intergenic
987333894 5:16881525-16881547 ACCTAGGAAAACTGGCCAATGGG - Intronic
987422368 5:17735621-17735643 ATGTAGGCACACAGGGCACTGGG - Intergenic
990547511 5:56837588-56837610 ATGTACAAATACTGGGCATTTGG + Intronic
990972679 5:61526080-61526102 ATGGATGAATGCTTGGCAATAGG + Intronic
994877945 5:105449458-105449480 AAGTAGGAATAATGAGCATTTGG - Intergenic
1003760961 6:9178277-9178299 ATGGAGCAATCCTGAGCAATGGG - Intergenic
1004103109 6:12635475-12635497 ATCTCTGAATACTGGGCAGTGGG + Intergenic
1005811826 6:29521668-29521690 ATGGAGGAATTCAGGGGAATGGG + Intergenic
1012237995 6:96839582-96839604 ATGTGTGTATACTGGGGAATGGG - Intergenic
1013542419 6:111123667-111123689 ATGTAGGTCTAAGGGGCAATAGG + Intronic
1014358665 6:120446251-120446273 AAGTAGAAATAATGGGCTATTGG + Intergenic
1017304711 6:152903651-152903673 ATGTAACAATACTGGGGAAATGG - Intergenic
1020419326 7:7983237-7983259 ATGTAGGAATTTTAGGAAATAGG + Intronic
1021174698 7:17437770-17437792 CTGTAGGAATATGGGGCACTAGG - Intergenic
1021734805 7:23632619-23632641 TTGTAGGGAAACTGGGCAAAGGG + Intronic
1026681852 7:72472918-72472940 ATCTAGAAATACAGGGCAAGGGG + Intergenic
1030072200 7:105707456-105707478 ATGGAGGAAGGCTGGGCTATGGG + Intronic
1030339276 7:108358439-108358461 ACGTAGGAATACTGGGACAGTGG - Intronic
1031625181 7:123984468-123984490 GTGTCAGAATACTGGGGAATGGG + Intergenic
1037378744 8:18261770-18261792 ATTTAGGAAAACTTTGCAATGGG + Intergenic
1037700992 8:21273603-21273625 ATGCAGGAATTCTCGGCATTGGG + Intergenic
1038189343 8:25304859-25304881 ATGCAGGAACACTGGCCCATGGG - Intronic
1038814913 8:30892304-30892326 ATGTATGAATTCTGGGCTCTGGG + Intergenic
1041988708 8:63958326-63958348 GTGGAGGAATAATGAGCAATTGG + Intergenic
1042378552 8:68084644-68084666 ATGTAGGAAGACGGGGCTAGAGG + Intronic
1042454492 8:68984801-68984823 GTGGAGGAATCCTGGGCAGTAGG - Intergenic
1043914572 8:85906532-85906554 ATGTAGCAAAATTGAGCAATTGG - Intergenic
1047821155 8:128522384-128522406 ATATAGAGATACTGTGCAATAGG + Intergenic
1048719048 8:137301173-137301195 ATCTAGTACTACTGGGCAAATGG + Intergenic
1050193362 9:3053690-3053712 ATGTAAGAATTGTGGGCAATGGG - Intergenic
1051560576 9:18436567-18436589 CTGGAGACATACTGGGCAATTGG - Intergenic
1052386142 9:27825565-27825587 GTGTATGGATACTGGGCAATGGG + Intergenic
1052421791 9:28251920-28251942 ATGAAAGAATACTGGGCCAAGGG + Intronic
1056442362 9:86633730-86633752 ATGGAGGGATACTGGGCACATGG + Intergenic
1056985790 9:91362636-91362658 ATTTAAGAATACTGGGCAGGGGG + Intergenic
1187482499 X:19670762-19670784 TTGTAGCAAGACTGGGTAATGGG - Intronic
1190056099 X:47181836-47181858 CTGTAGGATTCCTGGGCAGTGGG - Exonic
1197605195 X:128577300-128577322 CTGTAGGAATATTGGGCTTTTGG + Intergenic
1201851172 Y:18482141-18482163 CTTTAGGACTACTGTGCAATAGG - Intergenic
1201882147 Y:18838237-18838259 CTTTAGGACTACTGTGCAATAGG + Intergenic
1202076516 Y:21042482-21042504 TAGTAGGAATCCTGGGCTATGGG + Intergenic