ID: 904766462

View in Genome Browser
Species Human (GRCh38)
Location 1:32852508-32852530
Sequence AGTTTAGAACAGATGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 223}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904766462_904766467 18 Left 904766462 1:32852508-32852530 CCCACCTCCATCTGTTCTAAACT 0: 1
1: 0
2: 0
3: 22
4: 223
Right 904766467 1:32852549-32852571 TATTTGCTGTCTTTTGTCTCTGG 0: 1
1: 0
2: 5
3: 41
4: 448
904766462_904766469 20 Left 904766462 1:32852508-32852530 CCCACCTCCATCTGTTCTAAACT 0: 1
1: 0
2: 0
3: 22
4: 223
Right 904766469 1:32852551-32852573 TTTGCTGTCTTTTGTCTCTGGGG 0: 1
1: 0
2: 4
3: 110
4: 642
904766462_904766468 19 Left 904766462 1:32852508-32852530 CCCACCTCCATCTGTTCTAAACT 0: 1
1: 0
2: 0
3: 22
4: 223
Right 904766468 1:32852550-32852572 ATTTGCTGTCTTTTGTCTCTGGG 0: 1
1: 0
2: 4
3: 50
4: 475

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904766462 Original CRISPR AGTTTAGAACAGATGGAGGT GGG (reversed) Intronic
901468692 1:9440697-9440719 AGTTTCCAACACATGGATGTTGG + Intergenic
901743741 1:11359082-11359104 TGCTTGGAACAGATGGAGGAGGG - Intergenic
903834372 1:26193338-26193360 AGGTTAGGACAGATGGAGCTTGG + Intronic
903893780 1:26588748-26588770 ATTTTAGTACAGATGGGGTTTGG + Intergenic
904672528 1:32176667-32176689 ACTTTAGAGCAGGTGCAGGTTGG - Intergenic
904766462 1:32852508-32852530 AGTTTAGAACAGATGGAGGTGGG - Intronic
905190166 1:36227579-36227601 AGCCTACAACAGATGGAGGGAGG + Intronic
906045547 1:42828102-42828124 ATGTTAGAAGAGATGGAGGAAGG + Intronic
908261858 1:62345270-62345292 CGTTAAGAGCAGATGGAGGCTGG + Intergenic
910343082 1:86210003-86210025 AGTTAAGAATAGAGGGAAGTGGG + Intergenic
911557096 1:99357481-99357503 AGGTGAGAACGGATGGAGTTTGG - Intergenic
912524334 1:110269871-110269893 TCTTTAGAACGGAGGGAGGTTGG - Intronic
915074140 1:153295137-153295159 AGTTCATAAGGGATGGAGGTTGG + Intergenic
916600076 1:166284047-166284069 AGTTTGGAAAAGGTGGAGATTGG + Intergenic
916633770 1:166645578-166645600 AAATTAGAACACATAGAGGTAGG + Intergenic
916954185 1:169814839-169814861 ATTTTAGACCACATGGGGGTTGG + Intronic
917557459 1:176105146-176105168 GGAGTAGAAAAGATGGAGGTAGG + Intronic
917761770 1:178168123-178168145 AGACTAGAACATATGCAGGTGGG - Intronic
919957108 1:202428551-202428573 ATTTTAGAACAGATACAAGTAGG + Intronic
920193008 1:204206888-204206910 AGTGTAGAACAGGTGGAGGAGGG - Intronic
921151863 1:212409139-212409161 ATTTTTCCACAGATGGAGGTTGG - Intronic
921374763 1:214462368-214462390 AGTTTATAACAAATGGTGGGAGG - Intronic
922403791 1:225289883-225289905 AGATTGGAATAGATGGATGTGGG + Intronic
923397395 1:233580576-233580598 AGACAAGAACAGATGGAGGAAGG - Intergenic
924062216 1:240186743-240186765 AAGTTGGGACAGATGGAGGTGGG + Intronic
924098457 1:240578901-240578923 ATTTTGGAACAGCTGCAGGTGGG + Intronic
1064296695 10:14085104-14085126 ATTTATAAACAGATGGAGGTGGG - Intronic
1064339684 10:14474825-14474847 TGATTAGAACAGCTGGAGGCTGG - Intergenic
1065256880 10:23878956-23878978 AGTTTAGAACATGTGGAATTGGG + Intronic
1065286972 10:24195552-24195574 AGAAAAGAACAGAGGGAGGTTGG + Intronic
1066757895 10:38729358-38729380 AGTTTCCAAGAGATGGAGGCAGG + Intergenic
1067430811 10:46243319-46243341 AGCTTAGAACAAATGGACCTAGG + Intergenic
1070306219 10:75240704-75240726 GCTTTAGAACAGATGGACTTGGG + Intergenic
1071275127 10:84047186-84047208 AGTTAATAATAGATGGATGTAGG - Intergenic
1071364006 10:84880208-84880230 AGTATGGAAGAGAGGGAGGTGGG + Intergenic
1071930450 10:90463641-90463663 AGTTCAGGACAGGAGGAGGTAGG + Intergenic
1072922068 10:99584814-99584836 AGCTTAGAGCAGATAGAGGTGGG + Intergenic
1073682498 10:105719421-105719443 ATTTTTCCACAGATGGAGGTGGG + Intergenic
1074010234 10:109471158-109471180 ATTTCAGAACAGATGGATGTAGG - Intergenic
1074962252 10:118457564-118457586 AGTTTAGAACAGCTTCAGCTGGG - Intergenic
1075600783 10:123767433-123767455 AGTATAGAAGAGAGGAAGGTAGG - Intronic
1075642915 10:124077832-124077854 AGTTGAGCACAGAGGGAGGCAGG + Intronic
1075667710 10:124242898-124242920 GCTTTAGAACAGAGTGAGGTCGG - Intergenic
1076115318 10:127891870-127891892 AATTTAGAAAACATGAAGGTAGG + Intronic
1080104251 11:28495327-28495349 AGTTTAGAAGGGCTGGAGGATGG + Intergenic
1080621134 11:33988070-33988092 AGTTTTGCAGAGAAGGAGGTAGG - Intergenic
1082783982 11:57306805-57306827 AGTTTAGGATGGAGGGAGGTGGG - Intronic
1086207442 11:84276340-84276362 AGTTTAGAACTTATGAAAGTGGG - Intronic
1086530362 11:87777822-87777844 AGTTTCCAACAGATGAAGTTTGG + Intergenic
1087234310 11:95701390-95701412 ACATTAGACTAGATGGAGGTGGG - Intergenic
1091287802 11:134417916-134417938 AGTTCAGACCACATGCAGGTTGG - Intergenic
1094416264 12:30218722-30218744 AGTATAAAACAGCTGCAGGTAGG + Intergenic
1095886124 12:47190342-47190364 GGGTTAGAACAGATGGAACTTGG - Intronic
1097801673 12:63921267-63921289 AGATTAGAACAAATGCAGTTAGG - Intronic
1098467212 12:70801196-70801218 AGTTGGAAACAGATGGAGTTGGG + Intronic
1099394074 12:82116709-82116731 AATCTAGAACAGATGGTGATGGG - Intergenic
1099923056 12:88983010-88983032 AGTTTAGATCAGATAGAGTGGGG - Intergenic
1100182892 12:92104701-92104723 AATTAATAACAGATGTAGGTGGG + Intronic
1102467799 12:113140337-113140359 AGATTATAAGAGATGGTGGTGGG + Intergenic
1103173050 12:118838395-118838417 AGGATAGAACAGATGCAGGGAGG - Intergenic
1106816557 13:33414629-33414651 AGTTAAGGACAGGTGGGGGTGGG + Intergenic
1107845329 13:44506734-44506756 AGTATGGAAAAGATGGAAGTGGG + Intronic
1108346627 13:49552832-49552854 AGTTTAGAAGATAAGTAGGTGGG + Intronic
1113475601 13:110578585-110578607 AGTTTGGAGCACATGGAGATGGG + Intergenic
1114556237 14:23563953-23563975 AGTTTAGAGCAGCTGGAGTAAGG - Intronic
1116122227 14:40735640-40735662 ATTTTAGTACAGGTGGAGGCTGG + Intergenic
1116295653 14:43104461-43104483 AGTTAAGAAATGATGGAGTTAGG + Intergenic
1117054641 14:51899230-51899252 AGTCAAGAGCTGATGGAGGTAGG - Intronic
1117269405 14:54126592-54126614 GGTTTAGAACAGATGTTTGTTGG - Intergenic
1117283908 14:54267448-54267470 AGTTTTGTGCACATGGAGGTTGG - Intergenic
1117455336 14:55891275-55891297 AGTTTATAAGAGAAGAAGGTTGG + Intergenic
1118467524 14:66044410-66044432 AGTTTAGGACAGATGGGAGGAGG + Intergenic
1123441290 15:20294049-20294071 AGTTTTCAAGAGATGGAGGTGGG + Intergenic
1124905505 15:33864407-33864429 AGACTAGAAGAGCTGGAGGTGGG + Intronic
1125403253 15:39326752-39326774 AGTTATGAGCAGATGGAGGGAGG - Intergenic
1130968000 15:88711323-88711345 AGTTTGGAAGAGGTGGAGGATGG + Intergenic
1132593772 16:738823-738845 TTTTTAGTACAGATGGGGGTTGG + Intronic
1134136240 16:11678121-11678143 AGTTCAGAAGAGGTGGTGGTGGG + Exonic
1136362244 16:29788397-29788419 ATTTTTTAAGAGATGGAGGTAGG + Intergenic
1136540473 16:30925302-30925324 AGTTTACCCCAGATTGAGGTTGG + Intronic
1136719920 16:32311480-32311502 AGTTTCCAAGAGATGGAGGTGGG - Intergenic
1136724972 16:32349870-32349892 AGTTTCCAAGAGATGGAGGCGGG - Intergenic
1136838294 16:33517759-33517781 AGTTTCCAAGAGATGGAGGTGGG - Intergenic
1136843301 16:33555923-33555945 AGTTTCCAAGAGATGGAGGCGGG - Intergenic
1138176338 16:54901489-54901511 TGTTAAGAACAGATGGGGGCTGG - Intergenic
1138354371 16:56365786-56365808 AGATTAGAACAGAGGGAGAGTGG + Intronic
1141344000 16:83228692-83228714 AGTTTAGAGCAGACGAGGGTGGG + Intronic
1141596501 16:85100153-85100175 ACTGAAGAACAGATGGAGGGGGG + Exonic
1203001458 16_KI270728v1_random:167884-167906 AGTTTCCAAGAGATGGAGGCGGG + Intergenic
1203006511 16_KI270728v1_random:206289-206311 AGTTTCCAAGAGATGGAGGTGGG + Intergenic
1203148463 16_KI270728v1_random:1818044-1818066 AGTTTCCAAGAGATGGAGGTGGG - Intergenic
1203153466 16_KI270728v1_random:1856221-1856243 AGTTTCCAAGAGATGGAGGCGGG - Intergenic
1142847327 17:2688453-2688475 AGCTGAGAACAGATCGGGGTTGG - Intergenic
1145756762 17:27397713-27397735 AGTATTGAAAAGATGGAGGCTGG + Intergenic
1145763193 17:27439562-27439584 AGATTAGAACAAAAGCAGGTTGG - Intergenic
1148514468 17:48203391-48203413 AGTTTAGAAGACATGCAGCTCGG + Intronic
1149534660 17:57423560-57423582 AGCTCAGAACAGAAGGAGGATGG - Intronic
1149633682 17:58148719-58148741 AATTTAGAACAGAGGGTGGGAGG + Intergenic
1151291571 17:73154377-73154399 TGTTTAGAATAGATGGATGAAGG + Intergenic
1155649807 18:28127687-28127709 AGTTTATTACAGCTAGAGGTAGG + Intronic
1158512915 18:58107378-58107400 GGATTAGAACTGATGGAGGCAGG + Intronic
1159479055 18:68963578-68963600 AGTGAAGAACAGATGGAGCCAGG - Intronic
1159610092 18:70515065-70515087 TGTTAGGAACACATGGAGGTTGG - Intergenic
1159733441 18:72062080-72062102 ACTTTAGAGCAGATGGAGATAGG - Intergenic
1164895833 19:31876889-31876911 TGTTTCCAACAGATGGAAGTTGG + Intergenic
1165806108 19:38581774-38581796 TTTTTAGTAGAGATGGAGGTGGG + Intronic
1168063204 19:53905701-53905723 AGTGAAGGACAGAGGGAGGTCGG - Intronic
1168608741 19:57781629-57781651 AATTTAGAAGTGATGGAGGGTGG + Intronic
1168636263 19:57999710-57999732 AGTTTACAACAGTTGGAGTTTGG - Intronic
926176422 2:10596237-10596259 AGTTTTCCACAGATGGTGGTGGG + Intronic
927098915 2:19771899-19771921 AGTGCAGAACAGCTGGAGGGTGG + Intergenic
927975339 2:27334335-27334357 AGATGGGAACAGATAGAGGTAGG - Intronic
931364151 2:61604080-61604102 AGTGATGAATAGATGGAGGTGGG + Intergenic
931507314 2:62944176-62944198 AGTTTAGAAAATATGCTGGTTGG + Intronic
933471673 2:82733750-82733772 AGAATAGAACAGATGAAGCTTGG - Intergenic
934131125 2:88950117-88950139 ACTTTACAACAGATGGATTTTGG - Intergenic
934321204 2:91973800-91973822 AGTTTCCAAGAGATGGAGGCGGG + Intergenic
935388905 2:102530120-102530142 AGTTTAAAAAATGTGGAGGTGGG + Intronic
935423488 2:102894951-102894973 AGGTCAGACCAGATGGAAGTGGG + Intergenic
935902724 2:107809986-107810008 AGTTGAGAGCAGCTGCAGGTAGG + Intergenic
936332197 2:111557284-111557306 AGTATAGAATAGATAGGGGTGGG - Intergenic
937045935 2:118851837-118851859 AGTGTAGATCAGATGGCGGTGGG + Intergenic
939217050 2:139251746-139251768 AGTTTATAGGAGATGGAGATGGG - Intergenic
939966008 2:148610889-148610911 GGTGGAGAACAGATGGAGGAAGG + Intergenic
940211880 2:151263432-151263454 ATTTTAAAACAGAATGAGGTAGG + Intergenic
940391658 2:153139576-153139598 AGATATGAACAGATGGAGATGGG + Intergenic
945460742 2:210105074-210105096 AGTTGAGAACAGTTGGAGTGAGG - Intronic
946920083 2:224570589-224570611 AGTGGAGAACAGATGGGAGTGGG + Intronic
947802277 2:232937336-232937358 CATTTAGGACAGATGGAGGGAGG - Intronic
1169877036 20:10309359-10309381 GGCTAAGAACAGATGGAGTTTGG - Intergenic
1169896670 20:10511502-10511524 AAATTAAAACAGCTGGAGGTAGG - Intronic
1174045245 20:47728477-47728499 AGTGTGGAAGAGATGGGGGTGGG + Intronic
1176264178 20:64200093-64200115 AGGTGAGAACAGATAGAGATGGG - Intronic
1177264559 21:18765598-18765620 AGTTGGGAACAGATAGAGGAAGG - Intergenic
1177858393 21:26424969-26424991 AGTTAAGAACAGACTGACGTGGG + Intergenic
1180309451 22:11157772-11157794 AGTTTCCAAAAGATGGAGGCGGG + Intergenic
1180547928 22:16519583-16519605 AGTTTCCAAAAGATGGAGGCGGG + Intergenic
1181751738 22:24993644-24993666 AGTTTAGAGCAGGTGGAAGGTGG - Intronic
1181893590 22:26086319-26086341 CATTTACAACAGATAGAGGTTGG - Intergenic
1182032460 22:27170234-27170256 AGTTTGGAAGTGATGGAGCTGGG + Intergenic
1182211532 22:28680788-28680810 AGTTTTCAAGAGATGGAGGCGGG - Intergenic
1185010883 22:48313355-48313377 AGTTGTGACCAGATGGTGGTTGG - Intergenic
950812915 3:15666814-15666836 AGATTTGAACAGATGGAGAAGGG - Intergenic
951037463 3:17949834-17949856 GGTTTAGAACAGATGAAAGGGGG - Intronic
951429841 3:22593689-22593711 AATTTAGAAGGGTTGGAGGTTGG - Intergenic
953188332 3:40659369-40659391 AGTTAAGAAAAGATGGAGTGGGG - Intergenic
955793663 3:62613098-62613120 AGCTGAGACCAGATGGAGGAGGG + Intronic
957211079 3:77259798-77259820 AGGTTGGAACAGCTAGAGGTTGG - Intronic
958079487 3:88728137-88728159 AGTTTGGAAAAGATGATGGTTGG - Intergenic
959356304 3:105333960-105333982 AGATTGGAACAGAGGGAGCTAGG + Intergenic
962711612 3:138091254-138091276 AGCTAAGAAGAGATGGAGCTGGG - Intronic
963302765 3:143617425-143617447 GGATTAGAATAGATGGAGGCAGG + Intronic
966436409 3:179889235-179889257 AGTTTAGAGCTGATGGAAGGTGG + Intronic
966532488 3:180996259-180996281 AGTCTAAAACAGATGCAGGCTGG - Intergenic
969335569 4:6507533-6507555 TGGTTAGAACAGCTGGAGGCTGG - Intronic
972250872 4:37299353-37299375 AGTTTATTACAGAAGGGGGTTGG - Intronic
972770241 4:42190917-42190939 AGAATAGAACAGAAGGATGTAGG - Intergenic
972910464 4:43810281-43810303 GGTTTAGGCCAGATGCAGGTCGG + Intergenic
973981148 4:56309331-56309353 TGTGGAGAACAGACGGAGGTAGG + Intronic
974729830 4:65847825-65847847 AGTTTGGAAAAGGAGGAGGTAGG - Intergenic
974977222 4:68905944-68905966 AGATTGGAACATATGGAGGAGGG + Intergenic
975970683 4:80032029-80032051 ACTTTAGAAAAGATGAAGGAAGG + Intronic
978138594 4:105292775-105292797 ACTTTAGAGAAGATGGGGGTTGG + Intergenic
978277180 4:106966425-106966447 AATTTAGAAGAGATGGAGAGTGG - Intronic
978901921 4:113961399-113961421 ATGTTACATCAGATGGAGGTTGG + Intronic
979427270 4:120583372-120583394 ATTTTGGATCAGTTGGAGGTTGG + Intergenic
979729262 4:124003941-124003963 ATTTTTGAACAGAGGGAGGAAGG + Intergenic
981911599 4:149987744-149987766 ACTTTAGAAAAGAAGAAGGTGGG + Intergenic
982896920 4:160942005-160942027 AGTTTTCCACAGATGGGGGTGGG + Intergenic
983182140 4:164660655-164660677 AGCTTAGATCAGATGCAGGAGGG - Intergenic
983437594 4:167734636-167734658 AGTTTATAACTGAGGGAGGGAGG - Intergenic
983676201 4:170296268-170296290 AGTTTAGAGCAGAGGCTGGTGGG + Intergenic
986065384 5:4229612-4229634 AGGTCAGAGCAGAAGGAGGTGGG - Intergenic
986726080 5:10598088-10598110 AACTTAGAAGAGATGGAGGCTGG - Intronic
990130394 5:52575059-52575081 AGAGTAGAAAAGAGGGAGGTAGG - Intergenic
990648719 5:57874063-57874085 AGTTAAGAACAGAAATAGGTTGG - Intergenic
993137300 5:83985546-83985568 ATTTTAGAACAGAGGGTGTTTGG - Intronic
994613199 5:102071941-102071963 AGGTCAGAAAAGATAGAGGTTGG + Intergenic
994743499 5:103649958-103649980 AGTTTAGGACAGCTAGAAGTTGG - Intergenic
995795326 5:115935346-115935368 ACTTTAGAAGAGATGCAGGAAGG + Intergenic
996314287 5:122143994-122144016 TGTTTAGAACAGCTACAGGTGGG - Intronic
997786837 5:136721306-136721328 GGATTAGACCAGATGGAGGGAGG + Intergenic
998784073 5:145689892-145689914 TGTTTAGAAAAGCTGGAGTTTGG - Intronic
1000748592 5:165066499-165066521 AGTTTTGAACAGGTTGAGTTTGG + Intergenic
1003887139 6:10532046-10532068 AGATGAGAACACATGGAGCTGGG + Intronic
1004786915 6:18978399-18978421 AGTTTGTAAAACATGGAGGTGGG + Intergenic
1005287280 6:24341533-24341555 AGTTCAAAACAGATGGATGGAGG - Intronic
1006181501 6:32155897-32155919 AGGTTAGACCGCATGGAGGTGGG - Exonic
1006774430 6:36580934-36580956 AGTTTATAAAGGATGAAGGTAGG - Intergenic
1007648642 6:43402254-43402276 AGTTTAGAAAATATAGAGATTGG - Intergenic
1009405725 6:63310087-63310109 AGTTTTGTACAGATGGAGATAGG - Intronic
1009564188 6:65290215-65290237 AGTTTAGTAAAGATGGAGAAAGG + Intronic
1013004978 6:106064112-106064134 AGTTTATATCAGCTGGAGGTAGG + Intergenic
1013546057 6:111158787-111158809 AGTTTTGAAAAGATGTAGGCTGG + Intronic
1014674839 6:124351099-124351121 ATTTTAGATCAAATGAAGGTTGG + Intronic
1018551542 6:165003863-165003885 ATTTTAGAACTGAGGAAGGTAGG - Intergenic
1020752625 7:12161645-12161667 ATTTTAGAACACTTGGAGCTTGG + Intergenic
1021439414 7:20661062-20661084 TGTTGAGAACAGATTGAAGTGGG - Intronic
1021485050 7:21158259-21158281 AGTTAAGAATAGAGGGAGGCAGG - Intergenic
1022832034 7:34077280-34077302 AGTTGAGAAGATATGGAGTTAGG + Intronic
1023001780 7:35815312-35815334 TGTTTTGAACAGACAGAGGTAGG + Intronic
1024506159 7:50163811-50163833 ATTTTATAAGAGATTGAGGTGGG - Intergenic
1027028357 7:74870834-74870856 AGTTAGGATCAGCTGGAGGTCGG - Intergenic
1027269366 7:76511627-76511649 AGGAGAGAACAGATGGAGGTGGG - Intronic
1027320077 7:77005520-77005542 AGGAGAGAACAGATGGAGGTGGG - Intergenic
1028826980 7:95285079-95285101 AGGTTAGAGCACATGGAGCTAGG - Intronic
1028853064 7:95558318-95558340 AATTTAGAACTGAAGGAAGTGGG + Intergenic
1031107422 7:117562282-117562304 TGTGCAGAAAAGATGGAGGTTGG + Intronic
1031197807 7:118639033-118639055 AGTTCAGGACAGAATGAGGTGGG + Intergenic
1031275726 7:119720760-119720782 AATTCAGAACAGATGGAGGAAGG - Intergenic
1031496026 7:122449107-122449129 TGTTTAAAACAGTTGGAGGCAGG + Intronic
1031656897 7:124367168-124367190 TGTTTAGAACAGTGGGAGTTAGG + Intergenic
1032099059 7:128957996-128958018 AGTTTTGGACAAAGGGAGGTCGG - Intronic
1032650253 7:133870247-133870269 ACTTGAGTACAAATGGAGGTAGG - Intronic
1033959787 7:146900466-146900488 GGTTTAGAACAGTTGGGGATGGG - Intronic
1036832304 8:12030436-12030458 TGGTTAGAACAGAGGGAAGTAGG - Intergenic
1037779634 8:21858942-21858964 AGTTCAGAAAAGAAGTAGGTTGG + Intergenic
1038056815 8:23866430-23866452 AGGAGAGAACAGATGTAGGTTGG + Intergenic
1038715660 8:29988348-29988370 AGTTCAGAGCAGAGGGAGGTGGG - Intergenic
1041871718 8:62642154-62642176 AGCTCAGAACAGATGGGTGTAGG - Intronic
1044050904 8:87502688-87502710 TGTAGAGAACAGATGGGGGTGGG + Intronic
1045229783 8:100292963-100292985 ATTTTTCCACAGATGGAGGTGGG + Intronic
1045237049 8:100361351-100361373 AGTGTAGAACAGATGTAGGAAGG + Intronic
1045498924 8:102730274-102730296 AGTTTATAAGAAATGGAGGCTGG + Intergenic
1046824917 8:118678000-118678022 TTTTTAGATCAGATGGAGCTTGG + Intergenic
1046942878 8:119948022-119948044 AGTTAAGAAGAAATGGAAGTTGG - Intronic
1047688906 8:127330662-127330684 GATTTACAACAGATGGAGGCAGG + Intergenic
1049646121 8:143736508-143736530 GCTTTGGAACACATGGAGGTGGG + Intergenic
1050170258 9:2808536-2808558 GATTTAGTGCAGATGGAGGTAGG + Intronic
1050412919 9:5385022-5385044 AGATGAGGTCAGATGGAGGTGGG + Intronic
1052633156 9:31066928-31066950 AGTGTCAAATAGATGGAGGTTGG + Intergenic
1052786549 9:32833421-32833443 GGTTTGGAACAGAGGGAGGGAGG - Intergenic
1053112247 9:35471528-35471550 ACTTTAAATCAGATGGATGTTGG + Intergenic
1054453704 9:65418381-65418403 AGTCAAGAACAGAGGCAGGTTGG + Intergenic
1055003619 9:71481705-71481727 AGTTCAGAAAAGCTAGAGGTGGG + Intergenic
1056950907 9:91039986-91040008 CGGTCAGAACAGATGGAGGTGGG + Intergenic
1060239575 9:121891137-121891159 AGTTTAGAACAGCTAGAGATGGG - Intronic
1062162000 9:135085864-135085886 AGTTTGGAGCAGGTGCAGGTTGG + Intronic
1187692911 X:21889332-21889354 AAGTTAGAACAGAAGGAGATAGG + Intergenic
1188440582 X:30212088-30212110 AGGTTAAAAAAGATGGAGGCAGG + Intergenic
1189914404 X:45842675-45842697 AGTTTAGGACAGATGGAGTGTGG + Intergenic
1190777473 X:53564569-53564591 AGTTCACAAGAGATGCAGGTAGG - Exonic
1195790855 X:108583679-108583701 CAATTAGAATAGATGGAGGTAGG + Intronic
1198793161 X:140367758-140367780 AGTTAAGAGATGATGGAGGTTGG - Intergenic
1201685729 Y:16700119-16700141 AGTTTAGAACAGCTAGAAGGAGG - Intergenic
1202576758 Y:26335998-26336020 ATTTTAGAACAGATACAAGTAGG - Intergenic