ID: 904769076

View in Genome Browser
Species Human (GRCh38)
Location 1:32870940-32870962
Sequence CGTCCACGTCGGGCGCCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904769061_904769076 19 Left 904769061 1:32870898-32870920 CCGCGGACAGCGACTCCCGCGCG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 904769076 1:32870940-32870962 CGTCCACGTCGGGCGCCCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 61
904769068_904769076 3 Left 904769068 1:32870914-32870936 CCGCGCGGCGGCGGTGGCGGCGG 0: 1
1: 14
2: 123
3: 243
4: 754
Right 904769076 1:32870940-32870962 CGTCCACGTCGGGCGCCCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 61
904769067_904769076 4 Left 904769067 1:32870913-32870935 CCCGCGCGGCGGCGGTGGCGGCG 0: 1
1: 12
2: 72
3: 297
4: 909
Right 904769076 1:32870940-32870962 CGTCCACGTCGGGCGCCCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904769076 Original CRISPR CGTCCACGTCGGGCGCCCGG GGG Intronic
902514116 1:16980658-16980680 CAGCCCCGTCGGGGGCCCGGAGG - Exonic
904769076 1:32870940-32870962 CGTCCACGTCGGGCGCCCGGGGG + Intronic
1063663723 10:8049990-8050012 AGCCCACGCCGGGCGCCCGCGGG - Intergenic
1064354239 10:14603833-14603855 GGTCCACGCCGGGCGCCGCGGGG + Intronic
1065342898 10:24723404-24723426 AGCCCGCGGCGGGCGCCCGGCGG - Intronic
1074483940 10:113854846-113854868 CGGCCGCATCGGGAGCCCGGCGG + Exonic
1077002354 11:330617-330639 CGTGCACCTCGGGCGCCTTGAGG - Intergenic
1080045770 11:27806272-27806294 CGCCCACGCCGGGCGGCCGAGGG - Intergenic
1084979609 11:72822164-72822186 CGCGCACGTCGGGCTCCGGGAGG + Exonic
1087172728 11:95067238-95067260 CGTCCACGTCGGGAGGGGGGCGG - Exonic
1097057421 12:56258286-56258308 CGTCCGCATCGAGCTCCCGGCGG + Exonic
1097269797 12:57766975-57766997 CGCCCAACTCGGGCGCCCAGCGG + Exonic
1101102470 12:101407743-101407765 CTTCCACGTCGGACTCCAGGCGG + Exonic
1114231884 14:20790639-20790661 CGTCCACGTCGTTCCACCGGTGG - Intergenic
1122582002 14:102777181-102777203 CGTCCCCGCCGCGCGCCCCGCGG - Intergenic
1122719955 14:103716227-103716249 TGTCCAGGGCGGGCGCCGGGAGG + Intronic
1124327952 15:28783446-28783468 CGCCCGCCTCGGGCGTCCGGAGG + Intergenic
1132523464 16:401969-401991 CCTCCACGTCGGGCGGCGGCTGG - Exonic
1132737656 16:1394839-1394861 CCACCACGTCGGGCACCCGGTGG + Intronic
1132894886 16:2224020-2224042 TGTCTACACCGGGCGCCCGGGGG - Intronic
1142742232 17:1937869-1937891 CGTCCTCGGCGGGCGCCGGAGGG - Intronic
1160867204 19:1261204-1261226 GGTCCACGTGCGGCGCCCCGGGG - Intronic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
1166641918 19:44500663-44500685 CGTCCTCGTCCGGGGCCCGGGGG + Intergenic
947506790 2:230713449-230713471 CGCCGGCGTGGGGCGCCCGGGGG + Intronic
1180260884 21:46667947-46667969 CGTCCCCGCCGCGCGCTCGGAGG - Intergenic
1180612354 22:17106287-17106309 CGTCCACGTCTGGCGGCTGCAGG - Intronic
968221386 3:196942649-196942671 CGTCCGGGTCGGGCGCCGCGGGG + Intergenic
969763752 4:9211898-9211920 CGTCCAACTCGGGGGCCTGGAGG - Exonic
969764356 4:9216646-9216668 CGTCCAACTCGGGGGCCTGGAGG - Exonic
969764961 4:9221393-9221415 CGTCCAACTCGGGGGCCTGGAGG - Exonic
969765570 4:9226137-9226159 CGTCCAACTCGGGGGCCTGGAGG - Exonic
969766793 4:9235626-9235648 CGTCCAACTCGGGGGCCTGGAGG - Exonic
969767402 4:9240371-9240393 CGTCCAACTCGGGGGCCTGGAGG - Intronic
969768010 4:9245120-9245142 CGTCCAACTCGGGGGCCTGGAGG - Exonic
969768613 4:9249871-9249893 CGTCCAACTCGGGGGCCTGGAGG - Exonic
969769218 4:9254619-9254641 CGTCCAACTCGGGGGCCTGGAGG - Exonic
969769833 4:9259365-9259387 CGTCCAACTCGGGGGCCTGGAGG - Exonic
969770438 4:9264113-9264135 CGTCCAACTCGGGGGCCTGGAGG - Exonic
969771054 4:9268860-9268882 CGTCCAACTCGGGGGCCTGGAGG - Exonic
969772035 4:9326406-9326428 CGTCCAACTCGGGGGCCTGGAGG - Exonic
969772651 4:9331152-9331174 CGTCCAACTCGGGGGCCTGGAGG - Exonic
969773268 4:9335899-9335921 CGTCCAACTCGGGGGCCTGGAGG - Exonic
969773883 4:9340644-9340666 CGTCCAACTCGGGGGCCTGGAGG - Exonic
969774498 4:9345389-9345411 CGTCCAACTCGGGGGCCTGGAGG - Exonic
969775113 4:9350134-9350156 CGTCCAACTCGGGGGCCTGGAGG - Exonic
969775728 4:9354879-9354901 CGTCCAACTCGGGGGCCTGGAGG - Exonic
969776339 4:9359624-9359646 CGTCCAACTCGGGGGCCTGGAGG - Intronic
969776957 4:9364370-9364392 CGTCCAACTCGGGGGCCTGGAGG - Exonic
977323793 4:95549653-95549675 CGTCCAGGTCTGGCGCACCGCGG - Intergenic
990545189 5:56815431-56815453 AGTCCAGGCCAGGCGCCCGGCGG + Intergenic
990581900 5:57173816-57173838 CCTCTACGTCGGGCGCCTGGGGG - Intergenic
1001515143 5:172350372-172350394 CGTCACCGTCGGGCACCGGGCGG + Exonic
1002645042 5:180648924-180648946 CGTCCGCCTCGGGCGCGCGGTGG + Intronic
1018613403 6:165663289-165663311 CGCCCACGTAGCGCGCCCCGCGG + Intronic
1024256927 7:47546294-47546316 CGTCCACGTCCGGCACCCCCTGG + Intronic
1036273890 8:7333628-7333650 CGTCCAACTCGGGTGCCTGGAGG - Intergenic
1036347456 8:7976722-7976744 CGTCCAACTCGGGTGCCTGGAGG + Intergenic
1036842762 8:12137497-12137519 CGTCCAACTCGGGTGCCTGGAGG + Exonic
1038176227 8:25184365-25184387 CGCCCAGGCCGGGCGGCCGGTGG - Intergenic
1038596455 8:28890550-28890572 CTTCCGCGTGGGGCGCCCGTCGG - Exonic
1056167846 9:83956311-83956333 CGGCCTCGTCGGCCGCCCTGGGG + Exonic
1062600308 9:137316255-137316277 CGGCCACTCAGGGCGCCCGGCGG + Intronic
1185461226 X:333584-333606 CATCCACGTCGGGTGCCCCTGGG + Intergenic
1185618690 X:1439117-1439139 TGACCACGTCGGGGGCCCGCAGG + Exonic
1197766196 X:130060693-130060715 CCTCCACGTCCGGCGCGCCGGGG + Intergenic