ID: 904770526

View in Genome Browser
Species Human (GRCh38)
Location 1:32878679-32878701
Sequence CCCCATGCATAGTCTCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904770522_904770526 -10 Left 904770522 1:32878666-32878688 CCTCTGGCTCTAACCCCATGCAT No data
Right 904770526 1:32878679-32878701 CCCCATGCATAGTCTCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904770526 Original CRISPR CCCCATGCATAGTCTCAGGG AGG Intergenic
No off target data available for this crispr