ID: 904771161

View in Genome Browser
Species Human (GRCh38)
Location 1:32882205-32882227
Sequence GTCCCGCTCCTCTACGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904771155_904771161 -5 Left 904771155 1:32882187-32882209 CCAGAGGTCAAGGACCTTGTCCC No data
Right 904771161 1:32882205-32882227 GTCCCGCTCCTCTACGGGGTGGG No data
904771150_904771161 16 Left 904771150 1:32882166-32882188 CCAGGAAACCAACCGAAGCTTCC No data
Right 904771161 1:32882205-32882227 GTCCCGCTCCTCTACGGGGTGGG No data
904771149_904771161 27 Left 904771149 1:32882155-32882177 CCATTTACAGACCAGGAAACCAA No data
Right 904771161 1:32882205-32882227 GTCCCGCTCCTCTACGGGGTGGG No data
904771154_904771161 4 Left 904771154 1:32882178-32882200 CCGAAGCTTCCAGAGGTCAAGGA No data
Right 904771161 1:32882205-32882227 GTCCCGCTCCTCTACGGGGTGGG No data
904771152_904771161 8 Left 904771152 1:32882174-32882196 CCAACCGAAGCTTCCAGAGGTCA No data
Right 904771161 1:32882205-32882227 GTCCCGCTCCTCTACGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904771161 Original CRISPR GTCCCGCTCCTCTACGGGGT GGG Intergenic
No off target data available for this crispr