ID: 904773317

View in Genome Browser
Species Human (GRCh38)
Location 1:32893102-32893124
Sequence CACCGAGCGCGGGCCGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 93}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904773303_904773317 5 Left 904773303 1:32893074-32893096 CCCCCTTGGCCCGGCGCCCCCTT 0: 1
1: 0
2: 0
3: 15
4: 194
Right 904773317 1:32893102-32893124 CACCGAGCGCGGGCCGCCCTGGG 0: 1
1: 0
2: 0
3: 12
4: 93
904773306_904773317 2 Left 904773306 1:32893077-32893099 CCTTGGCCCGGCGCCCCCTTTCG 0: 1
1: 0
2: 1
3: 11
4: 144
Right 904773317 1:32893102-32893124 CACCGAGCGCGGGCCGCCCTGGG 0: 1
1: 0
2: 0
3: 12
4: 93
904773302_904773317 8 Left 904773302 1:32893071-32893093 CCGCCCCCTTGGCCCGGCGCCCC 0: 1
1: 0
2: 4
3: 30
4: 1047
Right 904773317 1:32893102-32893124 CACCGAGCGCGGGCCGCCCTGGG 0: 1
1: 0
2: 0
3: 12
4: 93
904773307_904773317 -4 Left 904773307 1:32893083-32893105 CCCGGCGCCCCCTTTCGACCACC 0: 1
1: 0
2: 1
3: 2
4: 84
Right 904773317 1:32893102-32893124 CACCGAGCGCGGGCCGCCCTGGG 0: 1
1: 0
2: 0
3: 12
4: 93
904773299_904773317 21 Left 904773299 1:32893058-32893080 CCGCAGCGCAGTGCCGCCCCCTT 0: 1
1: 0
2: 0
3: 9
4: 153
Right 904773317 1:32893102-32893124 CACCGAGCGCGGGCCGCCCTGGG 0: 1
1: 0
2: 0
3: 12
4: 93
904773308_904773317 -5 Left 904773308 1:32893084-32893106 CCGGCGCCCCCTTTCGACCACCG 0: 1
1: 0
2: 0
3: 5
4: 46
Right 904773317 1:32893102-32893124 CACCGAGCGCGGGCCGCCCTGGG 0: 1
1: 0
2: 0
3: 12
4: 93
904773304_904773317 4 Left 904773304 1:32893075-32893097 CCCCTTGGCCCGGCGCCCCCTTT 0: 1
1: 0
2: 1
3: 10
4: 170
Right 904773317 1:32893102-32893124 CACCGAGCGCGGGCCGCCCTGGG 0: 1
1: 0
2: 0
3: 12
4: 93
904773305_904773317 3 Left 904773305 1:32893076-32893098 CCCTTGGCCCGGCGCCCCCTTTC 0: 1
1: 0
2: 0
3: 14
4: 133
Right 904773317 1:32893102-32893124 CACCGAGCGCGGGCCGCCCTGGG 0: 1
1: 0
2: 0
3: 12
4: 93
904773297_904773317 23 Left 904773297 1:32893056-32893078 CCCCGCAGCGCAGTGCCGCCCCC 0: 1
1: 0
2: 3
3: 11
4: 229
Right 904773317 1:32893102-32893124 CACCGAGCGCGGGCCGCCCTGGG 0: 1
1: 0
2: 0
3: 12
4: 93
904773298_904773317 22 Left 904773298 1:32893057-32893079 CCCGCAGCGCAGTGCCGCCCCCT 0: 1
1: 0
2: 1
3: 20
4: 210
Right 904773317 1:32893102-32893124 CACCGAGCGCGGGCCGCCCTGGG 0: 1
1: 0
2: 0
3: 12
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904773317 Original CRISPR CACCGAGCGCGGGCCGCCCT GGG Intronic
900106120 1:981849-981871 CCCCTAGAGGGGGCCGCCCTCGG + Intronic
900245597 1:1634726-1634748 CACCGAGAGCTGGGCGTCCTCGG + Intronic
900256826 1:1701883-1701905 CACCGAGAGCTGGGCGTCCTCGG + Intronic
900328078 1:2120582-2120604 CACCGTGCCCGGCCAGCCCTTGG + Intronic
900375167 1:2350946-2350968 CACAGAGGTCGGGCTGCCCTGGG - Intronic
900558223 1:3290637-3290659 CAGCCAGCGCTGGCCGGCCTGGG - Intronic
904005623 1:27361702-27361724 CACCAAGCACTGGTCGCCCTGGG + Exonic
904500134 1:30908546-30908568 CACCGTGCCGGGGCCGCCCACGG - Exonic
904773317 1:32893102-32893124 CACCGAGCGCGGGCCGCCCTGGG + Intronic
904942769 1:34176894-34176916 CTCGGTGCGCGGGGCGCCCTGGG - Intronic
905043206 1:34976970-34976992 CAGCGCGCGCGGGGCGCCGTAGG + Intergenic
906627141 1:47334262-47334284 CGCCGCGCGCCGGCGGCCCTCGG - Intronic
910892201 1:92029951-92029973 CACGGAACGCCGGCCGCCCCGGG + Intergenic
914824571 1:151132143-151132165 CAGCGCGCGCGGCCCGCCCGGGG + Exonic
916667052 1:166975788-166975810 TCCCGAGCGCGGGCGTCCCTGGG - Intronic
919403235 1:197146371-197146393 GACCGAGCGGAGGCCGCCCGCGG - Exonic
923744400 1:236686812-236686834 CACCACGCGCGGGCGGCCCGCGG - Intronic
1063393574 10:5666209-5666231 CACCGAGCGCCGCGCGCCCTGGG - Intronic
1065624758 10:27619200-27619222 CACCCAGTGCTGGTCGCCCTTGG + Intergenic
1067972814 10:50991734-50991756 CAGCGAGCAGGGGGCGCCCTGGG - Intronic
1070198009 10:74176721-74176743 CCCCGCGCGCGGGCGGCCCCTGG - Intronic
1070305042 10:75234806-75234828 CACAGAGCCCGGGCCGGCCTGGG - Intronic
1070570725 10:77637963-77637985 CCCCGGGCGCGGGCGGCCCGCGG - Intronic
1075769039 10:124917508-124917530 TACCGACCGCCGGCCGCCCGTGG + Intergenic
1077095734 11:798296-798318 CGCCGCGCGCGCTCCGCCCTCGG + Exonic
1083766584 11:64844371-64844393 CACGGAGCGGGGGCGGGCCTAGG - Intronic
1101131812 12:101697814-101697836 CACCGAGCGCAGCCCGCGCCTGG - Exonic
1103377778 12:120469891-120469913 CCCCGAGCGCGGTTCGCGCTCGG + Exonic
1122293876 14:100694208-100694230 CACAGAGCGGGGGCGGCCCTTGG + Intergenic
1122604522 14:102939390-102939412 CACAGGCCTCGGGCCGCCCTGGG - Intronic
1132662111 16:1066201-1066223 GAGGGAGCCCGGGCCGCCCTGGG + Intergenic
1132875627 16:2135722-2135744 CTCCGCGCGCGGGCGGGCCTGGG - Exonic
1134519359 16:14911631-14911653 CTCCGCGCGCGGGCGGGCCTGGG + Intronic
1134554574 16:15154597-15154619 CTCCGCGCGCGGGCGGGCCTGGG - Intergenic
1134707029 16:16310286-16310308 CTCCGCGCGCGGGCGGGCCTGGG + Intergenic
1134960511 16:18401838-18401860 CTCCGCGCGCGGGCGGGCCTGGG - Intergenic
1141584908 16:85027602-85027624 CACCGAGCGTGGGCAGGCCTCGG + Intergenic
1142379230 16:89722098-89722120 CACCGCGGGCAGGTCGCCCTGGG + Intronic
1143030386 17:3964211-3964233 CGCCGGGCTCAGGCCGCCCTCGG + Exonic
1143496430 17:7315249-7315271 CACCGCGCGCGGGCGGCGCCGGG + Intronic
1147110366 17:38257154-38257176 CACCGAGCGCGGGCGACCGCCGG + Intergenic
1148110930 17:45144387-45144409 CTCCCAGCCCGGGCCACCCTTGG - Intergenic
1148419144 17:47531277-47531299 CACCGAGCGCGGGCGACCGCCGG - Exonic
1152468004 17:80476529-80476551 CCCAGAGCGCGGGCCGCTCGCGG - Exonic
1153514431 18:5891173-5891195 CGCCGAGCGGCGGCCGCCCTCGG - Exonic
1160579460 18:79875328-79875350 CACGGAGCACAGGCGGCCCTGGG + Intronic
1161108768 19:2456904-2456926 CGCCGAGCCCGGGCCGCCGTCGG - Exonic
1161393990 19:4035105-4035127 CACCGTGCCAGGGCCGCCCCAGG - Intronic
1161946478 19:7440449-7440471 CACCGAGCCCGGCTGGCCCTGGG + Exonic
1162929763 19:13952088-13952110 GACCGGGCGCGGGCAGCCCGGGG + Intronic
1166489750 19:43248442-43248464 CACCGCGCCCGGCCCGCACTTGG + Intronic
1167344592 19:48937294-48937316 CTCCGAGCCCGGGCGGACCTCGG + Intronic
1168641411 19:58034142-58034164 CACCGCGCGCGGGCTTCGCTCGG - Exonic
925959739 2:9003707-9003729 CTCCGACCGCGGGCGGCCCAGGG - Exonic
929780332 2:44953037-44953059 GACCGGGAGCGGGCGGCCCTGGG + Intergenic
935396955 2:102619510-102619532 CCCCGCCCGCGGGCCGCCCTGGG + Intergenic
939629821 2:144517467-144517489 AAACGCGCGCGGGCCGCCCAGGG + Intronic
941929933 2:170929323-170929345 CACCGATCGCCCGCCGCCATGGG + Exonic
946622144 2:221572427-221572449 CACCGAGCAGGGCCCGCCCCAGG + Intronic
947847049 2:233252674-233252696 CACCGAGCCCGGCCCCACCTTGG + Intronic
1172469405 20:35180395-35180417 CACCGAGTGAGGGCAGCCCTGGG - Intergenic
1172702723 20:36863033-36863055 ACCCGAGCGCGGACGGCCCTTGG + Exonic
1172764828 20:37345926-37345948 CCCCCAGCTCGGGCCGCCCCTGG + Intronic
1174053781 20:47785028-47785050 CACCGAGCACAGGCGGCCCCGGG - Intronic
1175215905 20:57391607-57391629 CCCCGAGCGCGGGCTTCCCGCGG + Exonic
1181305956 22:21917407-21917429 CACCGGGCTCAGGCAGCCCTAGG + Intergenic
1181793052 22:25282810-25282832 CGCCGAGCAGGGGCTGCCCTGGG + Intergenic
1185222538 22:49636252-49636274 CACCCAGGGTGGGCCGCCCTGGG + Intronic
954432274 3:50477215-50477237 CACCGTGCCCGGCCCACCCTGGG + Intronic
954540839 3:51392119-51392141 CGGCGGGCGCGGGCGGCCCTGGG - Exonic
955687582 3:61562154-61562176 CGCCGAGCGCGGGGGGCCCGTGG + Exonic
961141901 3:124562983-124563005 CACCGAACGGAGCCCGCCCTTGG + Intronic
972325884 4:38014801-38014823 CAGCGAGCGCAGGCCGGGCTGGG - Exonic
973604978 4:52577744-52577766 CACTGAGCTCTGGCCGCACTGGG - Intergenic
979033151 4:115678439-115678461 GCCCCAGCGCGGGACGCCCTAGG - Intergenic
982484756 4:155953689-155953711 TACCGAGCGCGCGCCTCCCCGGG - Intronic
985589967 5:759468-759490 TACCGAGCTCGTGCTGCCCTGGG + Intronic
985639916 5:1058782-1058804 TGCCGAGAGCGGGCAGCCCTTGG - Intronic
987771037 5:22305598-22305620 CACTGAATGCAGGCCGCCCTAGG + Intronic
989147057 5:38259017-38259039 CCCCGAGCCCGGGCGGCGCTAGG + Intronic
989178729 5:38556246-38556268 CACCCCGCCCGGGCCGCCCCTGG + Intronic
998095648 5:139394402-139394424 CGCGGCGCGCCGGCCGCCCTTGG + Exonic
1001525200 5:172423929-172423951 CACCGCGCCCGGCCCGCCCTGGG + Intronic
1001561245 5:172670265-172670287 CGCCCAGAGCGGGCCGCCCACGG - Exonic
1002526174 5:179817172-179817194 GACGGGGCGCGGGCCGCCCGTGG - Intronic
1002897930 6:1389953-1389975 CACCGAGGGCGGGCCGCCGCCGG + Exonic
1006634545 6:35452553-35452575 CACCGGACGCGGGGCTCCCTGGG + Exonic
1010378597 6:75202755-75202777 CCCCCAGCGCTTGCCGCCCTGGG - Exonic
1019711460 7:2519965-2519987 CAGCGCGCGCCGGCCGCGCTCGG - Exonic
1022396004 7:29989072-29989094 CGACGCGCGCGGGCCGCCCCTGG - Intronic
1025017099 7:55448738-55448760 CAGCGAGCTGGGGCCGCGCTGGG - Intronic
1034313735 7:150111383-150111405 CACACAGGGCGGGCCGCGCTTGG - Intergenic
1034793164 7:153989413-153989435 CACACAGGGCGGGCCGCGCTTGG + Intronic
1035398153 7:158548484-158548506 CACCGAGCTCCGCCCGCTCTTGG + Intronic
1037337099 8:17801727-17801749 CACCTACCGCGGCCCGGCCTGGG - Intergenic
1045111593 8:98942215-98942237 CACCGTCCGCGGGCCCTCCTGGG - Intronic
1049663115 8:143829243-143829265 CCATGAGCGCGGGCGGCCCTCGG - Intronic
1049804601 8:144533190-144533212 CCCCGAGCGCCAGCTGCCCTGGG - Exonic
1051855324 9:21559282-21559304 CCCGGAGCGCCGGCCGCCCTTGG - Intergenic
1056732425 9:89177960-89177982 GTGCGGGCGCGGGCCGCCCTGGG - Intronic
1060209012 9:121699199-121699221 GCCCGAGCCCGGCCCGCCCTCGG + Intronic
1062364696 9:136203154-136203176 CTGCGCCCGCGGGCCGCCCTGGG + Exonic
1062412651 9:136432761-136432783 CACCGAGGGCGTGCCGTGCTGGG - Intronic
1185608073 X:1378613-1378635 CACAGACCGGGGGCCGTCCTGGG - Intronic
1196929608 X:120668474-120668496 CACTGAGTGTGGGCTGCCCTTGG - Intergenic
1198482317 X:137052427-137052449 CACCGCCCGCGGGCCACCCCTGG - Intergenic