ID: 904774444

View in Genome Browser
Species Human (GRCh38)
Location 1:32898111-32898133
Sequence CCAGCCTGGCCATACCACGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 128}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904774427_904774444 17 Left 904774427 1:32898071-32898093 CCTTCAAGCCCCCTCCAGCCTCC 0: 1
1: 1
2: 3
3: 78
4: 702
Right 904774444 1:32898111-32898133 CCAGCCTGGCCATACCACGATGG 0: 1
1: 1
2: 0
3: 14
4: 128
904774432_904774444 3 Left 904774432 1:32898085-32898107 CCAGCCTCCTCCCACCAACCACC 0: 1
1: 0
2: 11
3: 198
4: 1481
Right 904774444 1:32898111-32898133 CCAGCCTGGCCATACCACGATGG 0: 1
1: 1
2: 0
3: 14
4: 128
904774435_904774444 -7 Left 904774435 1:32898095-32898117 CCCACCAACCACCCTCCCAGCCT 0: 1
1: 0
2: 6
3: 83
4: 1042
Right 904774444 1:32898111-32898133 CCAGCCTGGCCATACCACGATGG 0: 1
1: 1
2: 0
3: 14
4: 128
904774425_904774444 29 Left 904774425 1:32898059-32898081 CCTGTTGAAGACCCTTCAAGCCC 0: 1
1: 0
2: 3
3: 7
4: 106
Right 904774444 1:32898111-32898133 CCAGCCTGGCCATACCACGATGG 0: 1
1: 1
2: 0
3: 14
4: 128
904774434_904774444 -4 Left 904774434 1:32898092-32898114 CCTCCCACCAACCACCCTCCCAG 0: 1
1: 3
2: 14
3: 178
4: 1466
Right 904774444 1:32898111-32898133 CCAGCCTGGCCATACCACGATGG 0: 1
1: 1
2: 0
3: 14
4: 128
904774436_904774444 -8 Left 904774436 1:32898096-32898118 CCACCAACCACCCTCCCAGCCTG 0: 1
1: 0
2: 6
3: 104
4: 1588
Right 904774444 1:32898111-32898133 CCAGCCTGGCCATACCACGATGG 0: 1
1: 1
2: 0
3: 14
4: 128
904774429_904774444 8 Left 904774429 1:32898080-32898102 CCCCTCCAGCCTCCTCCCACCAA 0: 1
1: 0
2: 7
3: 108
4: 921
Right 904774444 1:32898111-32898133 CCAGCCTGGCCATACCACGATGG 0: 1
1: 1
2: 0
3: 14
4: 128
904774433_904774444 -1 Left 904774433 1:32898089-32898111 CCTCCTCCCACCAACCACCCTCC 0: 2
1: 13
2: 289
3: 1452
4: 4135
Right 904774444 1:32898111-32898133 CCAGCCTGGCCATACCACGATGG 0: 1
1: 1
2: 0
3: 14
4: 128
904774428_904774444 9 Left 904774428 1:32898079-32898101 CCCCCTCCAGCCTCCTCCCACCA 0: 1
1: 1
2: 21
3: 251
4: 2067
Right 904774444 1:32898111-32898133 CCAGCCTGGCCATACCACGATGG 0: 1
1: 1
2: 0
3: 14
4: 128
904774431_904774444 6 Left 904774431 1:32898082-32898104 CCTCCAGCCTCCTCCCACCAACC 0: 1
1: 0
2: 19
3: 162
4: 1424
Right 904774444 1:32898111-32898133 CCAGCCTGGCCATACCACGATGG 0: 1
1: 1
2: 0
3: 14
4: 128
904774426_904774444 18 Left 904774426 1:32898070-32898092 CCCTTCAAGCCCCCTCCAGCCTC 0: 1
1: 0
2: 4
3: 39
4: 499
Right 904774444 1:32898111-32898133 CCAGCCTGGCCATACCACGATGG 0: 1
1: 1
2: 0
3: 14
4: 128
904774430_904774444 7 Left 904774430 1:32898081-32898103 CCCTCCAGCCTCCTCCCACCAAC 0: 1
1: 0
2: 13
3: 121
4: 1132
Right 904774444 1:32898111-32898133 CCAGCCTGGCCATACCACGATGG 0: 1
1: 1
2: 0
3: 14
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904774444 Original CRISPR CCAGCCTGGCCATACCACGA TGG Exonic
900604355 1:3517168-3517190 CCTGCCTGGCCCTGCCAGGAGGG - Intronic
900617031 1:3570126-3570148 CCAGCCTGAGCATAGCAAGATGG + Intronic
901936142 1:12628484-12628506 CGAGACTGGCCATACCATGCAGG - Intergenic
902160760 1:14528586-14528608 CCAGCCTGGCAAAACCAGGTTGG + Intergenic
902219045 1:14953138-14953160 TCAGCCTGTCCATTCCATGAGGG - Intronic
902828111 1:18991246-18991268 CCAGCCTGGCCTGGCCAAGATGG + Intergenic
903182176 1:21610295-21610317 CCCCTCTGGCCAGACCACGAAGG - Intronic
904774444 1:32898111-32898133 CCAGCCTGGCCATACCACGATGG + Exonic
906156873 1:43619130-43619152 CCATCCTGGCCTTCCTACGACGG + Exonic
908222275 1:62019324-62019346 CCAGCCTGGCCAAGCCAACATGG + Intronic
913255051 1:116945349-116945371 ACAGCCTGCACATAACACGAAGG + Intronic
913538836 1:119799677-119799699 CCAGCCTGGCTTTCCCAAGAGGG + Intronic
914890430 1:151617477-151617499 CCAGCCTGGCCTGACCAACATGG - Intronic
915847742 1:159285987-159286009 CCAGCCTGGACAAACCAGCATGG + Intergenic
922511477 1:226171736-226171758 CCAGCCTGGCCAACCCAACATGG - Intronic
923596755 1:235366379-235366401 CGAGGCTGGCCATGCCACGTGGG + Intergenic
924558094 1:245134453-245134475 CCAGCCTGGACATCCCATGGGGG - Intergenic
1062936725 10:1395775-1395797 CGAGCCTGGCCATCACAGGAGGG - Intronic
1063589954 10:7386123-7386145 TCAGCCTGGCCATCTCAGGATGG + Intronic
1065184125 10:23155997-23156019 CCAGCGTGGCCATCTCAGGATGG - Intergenic
1065493754 10:26308348-26308370 CAAGCCCGGCCACACCACGTGGG - Intergenic
1066465969 10:35650644-35650666 CCTGCCTGACCTGACCACGAGGG + Intergenic
1069750903 10:70744321-70744343 CCAGCCTGGGCAGCCCAGGAAGG - Intronic
1069871303 10:71534888-71534910 TCAGCCTGTCCAAACCAGGAGGG - Intronic
1072592258 10:96837284-96837306 CCAGCCTGGGCATACATAGAGGG - Intronic
1074790391 10:116880853-116880875 CCAGCCAGACGTTACCACGAGGG + Intronic
1075715279 10:124551842-124551864 CCAGCCTGACCTCACCACGGAGG + Intronic
1075747742 10:124739675-124739697 ACAGCTTGGCCAGACCACGCTGG - Intronic
1076090861 10:127684445-127684467 CCAGCCTGGCCAGAGCAAGGAGG - Intergenic
1078178829 11:8992711-8992733 CCAGCCTGGCCAAGCCAACATGG + Intronic
1078263747 11:9737195-9737217 CCAGCCTGCCCCTCCCAGGAAGG + Intronic
1078366111 11:10707829-10707851 CCAGCCTGCCCATACGAAGATGG + Intergenic
1083997703 11:66280217-66280239 CCAGCCTGGGCACTCCACAAGGG - Intronic
1084296618 11:68216360-68216382 CCAGCCTGGCCGGACCAAAAGGG + Intergenic
1086573280 11:88308765-88308787 CTAGGCTGGCCATGCCACGTGGG - Intronic
1088920036 11:114254001-114254023 CCAGCCTGGCAAGGCCACGTTGG + Intergenic
1090268066 11:125366989-125367011 TCACCCTGTCCATAGCACGATGG - Intronic
1097868385 12:64578942-64578964 CCAGCCTGGCCTGACCAACAAGG + Intergenic
1101176098 12:102153321-102153343 CAAGGCTGGCCATGCCACGTGGG - Intronic
1102384675 12:112498279-112498301 CCACCCTGACCAAACCATGACGG - Intronic
1102447559 12:113015265-113015287 CTAGCCTGGCCCTACAACCAAGG - Intergenic
1103359945 12:120347601-120347623 CCAGCCTGGCCCTACCTCAGAGG + Intronic
1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG + Intronic
1106559756 13:30838072-30838094 TCACCCTGGCCATAAGACGAAGG - Intergenic
1113635886 13:111918908-111918930 CCTGCCTGGCCATGGCACGAAGG + Intergenic
1118326973 14:64787860-64787882 TCAGCCAGGCCAGACCACTAGGG + Intronic
1121104603 14:91272141-91272163 CCAGACTGGCGATACTACAAAGG - Exonic
1121482373 14:94289110-94289132 CCAGCCAGGCCACACCCCCAGGG - Intronic
1125730239 15:41888921-41888943 CCAGCCTGGCCCCACCATGCAGG - Intronic
1127506643 15:59604318-59604340 CAAGGCTGGCCATACCATGCAGG + Intronic
1129757722 15:78108623-78108645 CAGGCCTGGCCTTACCACCATGG + Intronic
1134615240 16:15646379-15646401 CCAGCCTGGCCAAACCAACATGG + Intronic
1135587779 16:23684003-23684025 CCTGCCTGACCATTCCACCAAGG + Exonic
1139482016 16:67236017-67236039 CCAGCCTGGCCTGCCCAGGAGGG + Intronic
1140352854 16:74279428-74279450 CGAGGCTGGCCATGCCACGAGGG + Intergenic
1140481250 16:75264065-75264087 GCAGCCTGGCCACACCATCACGG - Intronic
1141667941 16:85475465-85475487 CCAGCCTGGCCATGCCGAGGTGG + Intergenic
1142027300 16:87821370-87821392 CAAGGCTGGCCATGCCACAAGGG + Intergenic
1142123644 16:88399539-88399561 CCAGCCTGGCCCTCCCATGAAGG - Intergenic
1142713539 17:1736177-1736199 CGAGGCTGGCCAGCCCACGAGGG + Exonic
1145888204 17:28397077-28397099 CCAGCTGGGCCAGACCAGGAAGG - Exonic
1146937791 17:36823503-36823525 CCAGCCTGGCCCTACCCTGGTGG + Intergenic
1147045123 17:37745825-37745847 CCAGCCTGGCCACGCCACTGGGG + Intergenic
1147318592 17:39632834-39632856 CCAGCCTGGCCCTACCCCTCTGG + Intronic
1151242328 17:72767882-72767904 CGAGGCTGGCCATACCACTTGGG + Intronic
1151653334 17:75483658-75483680 CCAGCCTGGCCAGGCCAACATGG - Intronic
1151741225 17:75983624-75983646 CAAGGCTGGCCACACCACGTGGG + Intronic
1152077923 17:78170001-78170023 CCAGCATGGCCTTCCCAAGAGGG + Intronic
1152516513 17:80827935-80827957 ACAGCCTGGCCCTACCATGCAGG - Intronic
1153550410 18:6256823-6256845 CCAGCCTGGCCTGCCCACGGCGG - Intronic
1154255918 18:12780718-12780740 CCAGCCTGGCCTGACCAACATGG - Intergenic
1158240285 18:55370002-55370024 CCAGCCTGGCCATCCCATCGTGG + Intronic
1160765798 19:807115-807137 CCAGCCTGGCCCTCCCTCGCGGG + Intronic
1161574208 19:5046962-5046984 CCAGCTTGGCCCTTCCAGGAAGG - Intronic
1161596544 19:5153795-5153817 CCAGCCTGGCCACAGCATGAGGG - Intergenic
1163317365 19:16550281-16550303 CCAGCCAGACCATACCCTGATGG + Exonic
1165226105 19:34356287-34356309 CCAGCCTGGCGACAGAACGATGG + Intergenic
1165294890 19:34918603-34918625 AGAGGCTGGCCATGCCACGAGGG - Intergenic
1166733030 19:45069291-45069313 CCTGCCTGGCCTTCCCACCATGG + Intronic
1167854229 19:52225215-52225237 CCAGCCTGGCCAAACCAACATGG - Intronic
925293973 2:2765850-2765872 CCAGTCTTGCCATCCCACTAAGG + Intergenic
926383828 2:12316794-12316816 GAAGTCTGGCCATACCACGTGGG + Intergenic
933080306 2:77977103-77977125 CCAGCCTGCTCAGACCACCATGG - Intergenic
933899886 2:86841870-86841892 CCAGCCTGGGAAGACCAAGAGGG + Intronic
935780673 2:106507355-106507377 CCAGCCTGGGAAGACCAAGAGGG - Intergenic
938137372 2:128770354-128770376 CGAGCCTGGGCACACCACCAGGG - Intergenic
947745770 2:232506594-232506616 CCAGCCTGGCCCTCCCTGGAGGG - Intergenic
948376825 2:237526123-237526145 CCATCCTGCCCAGACCAGGATGG - Intronic
948990718 2:241552528-241552550 CCTGCCTGGCCCTACCACTCCGG - Intergenic
1172669134 20:36622122-36622144 CCAGCCTGGCCAACCCATGGTGG + Intronic
1173229217 20:41181053-41181075 CCAGCCTGCCCAGACCACGGGGG - Exonic
1174696133 20:52560752-52560774 ACAGCCTGGCCATTCCACCCAGG - Intergenic
1174770659 20:53297054-53297076 CCAGCATGGCCAGATCACCAGGG - Intronic
1175943815 20:62549772-62549794 CCAGCCAGGCCCTGCCACCAAGG - Intergenic
1176293833 21:5060103-5060125 CCAGGCTGGCCATGCCACGTGGG - Intergenic
1179707913 21:43193009-43193031 CCAGCCTGGCCATCCCCTCAGGG - Intergenic
1179795594 21:43781060-43781082 CTGGCCTGGCCATGCCACAAGGG - Intergenic
1179863426 21:44203545-44203567 CCAGGCTGGCCATGCCACGTGGG + Intergenic
1182750111 22:32634723-32634745 CCAGCCTGGGGAAACCAAGAAGG - Intronic
1183440850 22:37822424-37822446 CCAGCCCGGCCATTCCACCCAGG + Intergenic
1183891249 22:40930764-40930786 CCAGCCTGGCCTGGCCAAGATGG - Exonic
1184207298 22:43013628-43013650 CCAACCTGGCAATCCCAGGAGGG + Intronic
949200190 3:1367898-1367920 CCAGCTTGCCCATACCTCGCCGG + Intronic
951349164 3:21584172-21584194 CCAGCCTGGCCAAACTGAGATGG - Intronic
951871095 3:27363159-27363181 CCAGCCTTTCCATACCACTGTGG - Intronic
952267456 3:31800426-31800448 CCAGCCTGGCCCTGGCATGATGG + Intronic
953466309 3:43123143-43123165 CCAGCCTGGCCAACCCAGGCTGG + Intergenic
962947743 3:140187259-140187281 GCAGGCTGGCCATACCACTGGGG + Intronic
968762367 4:2449359-2449381 CCACCCTGGCCATCCCATGCTGG + Intronic
969640534 4:8395665-8395687 CATGCCTGGCCTTACCACCAAGG - Intronic
969700502 4:8765148-8765170 CCAGCCTGGCTACACCACCCAGG - Intergenic
969922414 4:10552745-10552767 CGAGGCTGGCCACACCACGTGGG - Intronic
969944839 4:10772650-10772672 CCAGCCCAGCCACACCACAATGG + Intergenic
975215004 4:71742967-71742989 CCACCCTGCCCACACCAAGACGG - Intronic
975497038 4:75046489-75046511 CCAGCCAGGCCAGACCACCATGG + Exonic
975851208 4:78574221-78574243 CCAGCCTGGCAATATAAGGAGGG + Intronic
975856922 4:78634342-78634364 CCAGCCTGGGGACACCACGTGGG - Intergenic
976826141 4:89262600-89262622 TCAGCCTGGCCATGCAACTAAGG + Intronic
979516246 4:121613347-121613369 CCAGCCTGACCTGACCAAGATGG - Intergenic
982158242 4:152541314-152541336 CCTGCCTGGCCATATGAGGATGG + Intergenic
986404580 5:7412870-7412892 CCTGCCTGCCCCTACCAGGATGG + Intronic
997622517 5:135307948-135307970 CCAGCCTGGGCACACCATCAGGG - Intronic
999446611 5:151645501-151645523 CCAGTGTGGACATACCACGCTGG + Intergenic
1004373328 6:15071450-15071472 CCAGCCTGGGCCTATCAGGATGG - Intergenic
1005385065 6:25278315-25278337 ACAGCCAGGCCTTACCACTAAGG - Intergenic
1014724314 6:124956407-124956429 CCAGCCTGCCACTACCACAAAGG + Intergenic
1017822424 6:158059346-158059368 ACAGCCTGGCCTTACCTTGAAGG - Exonic
1019595134 7:1854880-1854902 CCAGGCAGGCCAAACCCCGAGGG + Intronic
1025042729 7:55662306-55662328 CCAGCCTGCCCAACCCACCAGGG + Intergenic
1029560646 7:101300422-101300444 ACAGCCTGCCGATACCACCACGG + Intergenic
1033010694 7:137619458-137619480 CCAGCCTGGGCATTCCCAGAGGG - Intronic
1040324433 8:46334538-46334560 CCAGCCTGACCACACCACCCTGG - Intergenic
1046866248 8:119153554-119153576 GAAGCCTGGACATACCACTAAGG + Intergenic
1049270187 8:141691444-141691466 CCAGCCAGGCCATACCCAGTTGG + Intergenic
1049599404 8:143500060-143500082 CCAGCATGGCCATACCACGAAGG - Intronic
1050196614 9:3090970-3090992 CCAGCCTGACCAAACCAACATGG - Intergenic
1057108887 9:92448197-92448219 CAAGGCTGGCCACACCACGTGGG + Intronic
1061832254 9:133303597-133303619 CCAGCCTTGCACTCCCACGAGGG - Intergenic
1061931119 9:133833689-133833711 CAAGCCTGGCCACAGCACCAGGG - Intronic
1062316853 9:135971659-135971681 CCAGCCTAGCCAGAGCAGGAAGG - Intergenic
1186034839 X:5411263-5411285 CAAGCCTGGCCATGCCACGCGGG + Intergenic
1188010146 X:25046263-25046285 CCAGCCTGACCAGACCACCATGG + Intergenic
1195706398 X:107740990-107741012 CCAGCCTGGCCACACCTCAAGGG - Intronic
1199611126 X:149615195-149615217 TCAGCCTGCTAATACCACGAAGG - Intronic