ID: 904775072

View in Genome Browser
Species Human (GRCh38)
Location 1:32901403-32901425
Sequence CCGGGGGGTGACGGGAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 437}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904775072_904775088 5 Left 904775072 1:32901403-32901425 CCTCCCTTCCCGTCACCCCCCGG 0: 1
1: 0
2: 1
3: 38
4: 437
Right 904775088 1:32901431-32901453 CCGGCCCCGCAGCGCCCCCGCGG 0: 1
1: 1
2: 3
3: 59
4: 347
904775072_904775095 21 Left 904775072 1:32901403-32901425 CCTCCCTTCCCGTCACCCCCCGG 0: 1
1: 0
2: 1
3: 38
4: 437
Right 904775095 1:32901447-32901469 CCCGCGGCTCGTGCCCCTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 152
904775072_904775098 29 Left 904775072 1:32901403-32901425 CCTCCCTTCCCGTCACCCCCCGG 0: 1
1: 0
2: 1
3: 38
4: 437
Right 904775098 1:32901455-32901477 TCGTGCCCCTCCCGGCCGGTCGG 0: 1
1: 0
2: 0
3: 8
4: 50
904775072_904775097 25 Left 904775072 1:32901403-32901425 CCTCCCTTCCCGTCACCCCCCGG 0: 1
1: 0
2: 1
3: 38
4: 437
Right 904775097 1:32901451-32901473 CGGCTCGTGCCCCTCCCGGCCGG 0: 1
1: 0
2: 0
3: 11
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904775072 Original CRISPR CCGGGGGGTGACGGGAAGGG AGG (reversed) Intronic