ID: 904775075

View in Genome Browser
Species Human (GRCh38)
Location 1:32901406-32901428
Sequence GGCCCGGGGGGTGACGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 340}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904775075_904775088 2 Left 904775075 1:32901406-32901428 CCCTTCCCGTCACCCCCCGGGCC 0: 1
1: 0
2: 2
3: 17
4: 340
Right 904775088 1:32901431-32901453 CCGGCCCCGCAGCGCCCCCGCGG 0: 1
1: 1
2: 3
3: 59
4: 347
904775075_904775098 26 Left 904775075 1:32901406-32901428 CCCTTCCCGTCACCCCCCGGGCC 0: 1
1: 0
2: 2
3: 17
4: 340
Right 904775098 1:32901455-32901477 TCGTGCCCCTCCCGGCCGGTCGG 0: 1
1: 0
2: 0
3: 8
4: 50
904775075_904775097 22 Left 904775075 1:32901406-32901428 CCCTTCCCGTCACCCCCCGGGCC 0: 1
1: 0
2: 2
3: 17
4: 340
Right 904775097 1:32901451-32901473 CGGCTCGTGCCCCTCCCGGCCGG 0: 1
1: 0
2: 0
3: 11
4: 118
904775075_904775095 18 Left 904775075 1:32901406-32901428 CCCTTCCCGTCACCCCCCGGGCC 0: 1
1: 0
2: 2
3: 17
4: 340
Right 904775095 1:32901447-32901469 CCCGCGGCTCGTGCCCCTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904775075 Original CRISPR GGCCCGGGGGGTGACGGGAA GGG (reversed) Intronic