ID: 904775076

View in Genome Browser
Species Human (GRCh38)
Location 1:32901407-32901429
Sequence CGGCCCGGGGGGTGACGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 188}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904775076_904775098 25 Left 904775076 1:32901407-32901429 CCTTCCCGTCACCCCCCGGGCCG 0: 1
1: 0
2: 2
3: 13
4: 188
Right 904775098 1:32901455-32901477 TCGTGCCCCTCCCGGCCGGTCGG 0: 1
1: 0
2: 0
3: 8
4: 50
904775076_904775100 30 Left 904775076 1:32901407-32901429 CCTTCCCGTCACCCCCCGGGCCG 0: 1
1: 0
2: 2
3: 13
4: 188
Right 904775100 1:32901460-32901482 CCCCTCCCGGCCGGTCGGACCGG 0: 1
1: 0
2: 1
3: 4
4: 70
904775076_904775097 21 Left 904775076 1:32901407-32901429 CCTTCCCGTCACCCCCCGGGCCG 0: 1
1: 0
2: 2
3: 13
4: 188
Right 904775097 1:32901451-32901473 CGGCTCGTGCCCCTCCCGGCCGG 0: 1
1: 0
2: 0
3: 11
4: 118
904775076_904775095 17 Left 904775076 1:32901407-32901429 CCTTCCCGTCACCCCCCGGGCCG 0: 1
1: 0
2: 2
3: 13
4: 188
Right 904775095 1:32901447-32901469 CCCGCGGCTCGTGCCCCTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 152
904775076_904775088 1 Left 904775076 1:32901407-32901429 CCTTCCCGTCACCCCCCGGGCCG 0: 1
1: 0
2: 2
3: 13
4: 188
Right 904775088 1:32901431-32901453 CCGGCCCCGCAGCGCCCCCGCGG 0: 1
1: 1
2: 3
3: 59
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904775076 Original CRISPR CGGCCCGGGGGGTGACGGGA AGG (reversed) Intronic