ID: 904775078

View in Genome Browser
Species Human (GRCh38)
Location 1:32901412-32901434
Sequence CCGGGCGGCCCGGGGGGTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 440
Summary {0: 1, 1: 1, 2: 4, 3: 29, 4: 405}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904775078_904775098 20 Left 904775078 1:32901412-32901434 CCGTCACCCCCCGGGCCGCCCGG 0: 1
1: 1
2: 4
3: 29
4: 405
Right 904775098 1:32901455-32901477 TCGTGCCCCTCCCGGCCGGTCGG 0: 1
1: 0
2: 0
3: 8
4: 50
904775078_904775095 12 Left 904775078 1:32901412-32901434 CCGTCACCCCCCGGGCCGCCCGG 0: 1
1: 1
2: 4
3: 29
4: 405
Right 904775095 1:32901447-32901469 CCCGCGGCTCGTGCCCCTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 152
904775078_904775100 25 Left 904775078 1:32901412-32901434 CCGTCACCCCCCGGGCCGCCCGG 0: 1
1: 1
2: 4
3: 29
4: 405
Right 904775100 1:32901460-32901482 CCCCTCCCGGCCGGTCGGACCGG 0: 1
1: 0
2: 1
3: 4
4: 70
904775078_904775088 -4 Left 904775078 1:32901412-32901434 CCGTCACCCCCCGGGCCGCCCGG 0: 1
1: 1
2: 4
3: 29
4: 405
Right 904775088 1:32901431-32901453 CCGGCCCCGCAGCGCCCCCGCGG 0: 1
1: 1
2: 3
3: 59
4: 347
904775078_904775097 16 Left 904775078 1:32901412-32901434 CCGTCACCCCCCGGGCCGCCCGG 0: 1
1: 1
2: 4
3: 29
4: 405
Right 904775097 1:32901451-32901473 CGGCTCGTGCCCCTCCCGGCCGG 0: 1
1: 0
2: 0
3: 11
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904775078 Original CRISPR CCGGGCGGCCCGGGGGGTGA CGG (reversed) Intronic