ID: 904775081

View in Genome Browser
Species Human (GRCh38)
Location 1:32901419-32901441
Sequence TGCGGGGCCGGGCGGCCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 627
Summary {0: 1, 1: 2, 2: 2, 3: 56, 4: 566}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904775081_904775095 5 Left 904775081 1:32901419-32901441 CCCCCGGGCCGCCCGGCCCCGCA 0: 1
1: 2
2: 2
3: 56
4: 566
Right 904775095 1:32901447-32901469 CCCGCGGCTCGTGCCCCTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 152
904775081_904775097 9 Left 904775081 1:32901419-32901441 CCCCCGGGCCGCCCGGCCCCGCA 0: 1
1: 2
2: 2
3: 56
4: 566
Right 904775097 1:32901451-32901473 CGGCTCGTGCCCCTCCCGGCCGG 0: 1
1: 0
2: 0
3: 11
4: 118
904775081_904775098 13 Left 904775081 1:32901419-32901441 CCCCCGGGCCGCCCGGCCCCGCA 0: 1
1: 2
2: 2
3: 56
4: 566
Right 904775098 1:32901455-32901477 TCGTGCCCCTCCCGGCCGGTCGG 0: 1
1: 0
2: 0
3: 8
4: 50
904775081_904775100 18 Left 904775081 1:32901419-32901441 CCCCCGGGCCGCCCGGCCCCGCA 0: 1
1: 2
2: 2
3: 56
4: 566
Right 904775100 1:32901460-32901482 CCCCTCCCGGCCGGTCGGACCGG 0: 1
1: 0
2: 1
3: 4
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904775081 Original CRISPR TGCGGGGCCGGGCGGCCCGG GGG (reversed) Intronic