ID: 904775082

View in Genome Browser
Species Human (GRCh38)
Location 1:32901420-32901442
Sequence CTGCGGGGCCGGGCGGCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 592
Summary {0: 1, 1: 1, 2: 10, 3: 71, 4: 509}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904775082_904775095 4 Left 904775082 1:32901420-32901442 CCCCGGGCCGCCCGGCCCCGCAG 0: 1
1: 1
2: 10
3: 71
4: 509
Right 904775095 1:32901447-32901469 CCCGCGGCTCGTGCCCCTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 152
904775082_904775100 17 Left 904775082 1:32901420-32901442 CCCCGGGCCGCCCGGCCCCGCAG 0: 1
1: 1
2: 10
3: 71
4: 509
Right 904775100 1:32901460-32901482 CCCCTCCCGGCCGGTCGGACCGG 0: 1
1: 0
2: 1
3: 4
4: 70
904775082_904775097 8 Left 904775082 1:32901420-32901442 CCCCGGGCCGCCCGGCCCCGCAG 0: 1
1: 1
2: 10
3: 71
4: 509
Right 904775097 1:32901451-32901473 CGGCTCGTGCCCCTCCCGGCCGG 0: 1
1: 0
2: 0
3: 11
4: 118
904775082_904775098 12 Left 904775082 1:32901420-32901442 CCCCGGGCCGCCCGGCCCCGCAG 0: 1
1: 1
2: 10
3: 71
4: 509
Right 904775098 1:32901455-32901477 TCGTGCCCCTCCCGGCCGGTCGG 0: 1
1: 0
2: 0
3: 8
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904775082 Original CRISPR CTGCGGGGCCGGGCGGCCCG GGG (reversed) Intronic