ID: 904775086

View in Genome Browser
Species Human (GRCh38)
Location 1:32901430-32901452
Sequence CGCGGGGGCGCTGCGGGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 793
Summary {0: 1, 1: 0, 2: 6, 3: 75, 4: 711}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904775086_904775098 2 Left 904775086 1:32901430-32901452 CCCGGCCCCGCAGCGCCCCCGCG 0: 1
1: 0
2: 6
3: 75
4: 711
Right 904775098 1:32901455-32901477 TCGTGCCCCTCCCGGCCGGTCGG 0: 1
1: 0
2: 0
3: 8
4: 50
904775086_904775095 -6 Left 904775086 1:32901430-32901452 CCCGGCCCCGCAGCGCCCCCGCG 0: 1
1: 0
2: 6
3: 75
4: 711
Right 904775095 1:32901447-32901469 CCCGCGGCTCGTGCCCCTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 152
904775086_904775097 -2 Left 904775086 1:32901430-32901452 CCCGGCCCCGCAGCGCCCCCGCG 0: 1
1: 0
2: 6
3: 75
4: 711
Right 904775097 1:32901451-32901473 CGGCTCGTGCCCCTCCCGGCCGG 0: 1
1: 0
2: 0
3: 11
4: 118
904775086_904775100 7 Left 904775086 1:32901430-32901452 CCCGGCCCCGCAGCGCCCCCGCG 0: 1
1: 0
2: 6
3: 75
4: 711
Right 904775100 1:32901460-32901482 CCCCTCCCGGCCGGTCGGACCGG 0: 1
1: 0
2: 1
3: 4
4: 70
904775086_904775106 22 Left 904775086 1:32901430-32901452 CCCGGCCCCGCAGCGCCCCCGCG 0: 1
1: 0
2: 6
3: 75
4: 711
Right 904775106 1:32901475-32901497 CGGACCGGCTGAGCAGCCCATGG 0: 1
1: 0
2: 0
3: 6
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904775086 Original CRISPR CGCGGGGGCGCTGCGGGGCC GGG (reversed) Intronic