ID: 904775087

View in Genome Browser
Species Human (GRCh38)
Location 1:32901431-32901453
Sequence CCGCGGGGGCGCTGCGGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 764
Summary {0: 1, 1: 0, 2: 5, 3: 82, 4: 676}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904775087_904775100 6 Left 904775087 1:32901431-32901453 CCGGCCCCGCAGCGCCCCCGCGG 0: 1
1: 0
2: 5
3: 82
4: 676
Right 904775100 1:32901460-32901482 CCCCTCCCGGCCGGTCGGACCGG 0: 1
1: 0
2: 1
3: 4
4: 70
904775087_904775106 21 Left 904775087 1:32901431-32901453 CCGGCCCCGCAGCGCCCCCGCGG 0: 1
1: 0
2: 5
3: 82
4: 676
Right 904775106 1:32901475-32901497 CGGACCGGCTGAGCAGCCCATGG 0: 1
1: 0
2: 0
3: 6
4: 97
904775087_904775097 -3 Left 904775087 1:32901431-32901453 CCGGCCCCGCAGCGCCCCCGCGG 0: 1
1: 0
2: 5
3: 82
4: 676
Right 904775097 1:32901451-32901473 CGGCTCGTGCCCCTCCCGGCCGG 0: 1
1: 0
2: 0
3: 11
4: 118
904775087_904775098 1 Left 904775087 1:32901431-32901453 CCGGCCCCGCAGCGCCCCCGCGG 0: 1
1: 0
2: 5
3: 82
4: 676
Right 904775098 1:32901455-32901477 TCGTGCCCCTCCCGGCCGGTCGG 0: 1
1: 0
2: 0
3: 8
4: 50
904775087_904775095 -7 Left 904775087 1:32901431-32901453 CCGGCCCCGCAGCGCCCCCGCGG 0: 1
1: 0
2: 5
3: 82
4: 676
Right 904775095 1:32901447-32901469 CCCGCGGCTCGTGCCCCTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904775087 Original CRISPR CCGCGGGGGCGCTGCGGGGC CGG (reversed) Intronic