ID: 904775089

View in Genome Browser
Species Human (GRCh38)
Location 1:32901435-32901457
Sequence CGAGCCGCGGGGGCGCTGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 197}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904775089_904775106 17 Left 904775089 1:32901435-32901457 CCCCGCAGCGCCCCCGCGGCTCG 0: 1
1: 0
2: 1
3: 18
4: 197
Right 904775106 1:32901475-32901497 CGGACCGGCTGAGCAGCCCATGG 0: 1
1: 0
2: 0
3: 6
4: 97
904775089_904775097 -7 Left 904775089 1:32901435-32901457 CCCCGCAGCGCCCCCGCGGCTCG 0: 1
1: 0
2: 1
3: 18
4: 197
Right 904775097 1:32901451-32901473 CGGCTCGTGCCCCTCCCGGCCGG 0: 1
1: 0
2: 0
3: 11
4: 118
904775089_904775098 -3 Left 904775089 1:32901435-32901457 CCCCGCAGCGCCCCCGCGGCTCG 0: 1
1: 0
2: 1
3: 18
4: 197
Right 904775098 1:32901455-32901477 TCGTGCCCCTCCCGGCCGGTCGG 0: 1
1: 0
2: 0
3: 8
4: 50
904775089_904775100 2 Left 904775089 1:32901435-32901457 CCCCGCAGCGCCCCCGCGGCTCG 0: 1
1: 0
2: 1
3: 18
4: 197
Right 904775100 1:32901460-32901482 CCCCTCCCGGCCGGTCGGACCGG 0: 1
1: 0
2: 1
3: 4
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904775089 Original CRISPR CGAGCCGCGGGGGCGCTGCG GGG (reversed) Intronic