ID: 904775095

View in Genome Browser
Species Human (GRCh38)
Location 1:32901447-32901469
Sequence CCCGCGGCTCGTGCCCCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 152}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904775077_904775095 13 Left 904775077 1:32901411-32901433 CCCGTCACCCCCCGGGCCGCCCG 0: 1
1: 0
2: 2
3: 19
4: 233
Right 904775095 1:32901447-32901469 CCCGCGGCTCGTGCCCCTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 152
904775083_904775095 3 Left 904775083 1:32901421-32901443 CCCGGGCCGCCCGGCCCCGCAGC 0: 1
1: 0
2: 10
3: 131
4: 740
Right 904775095 1:32901447-32901469 CCCGCGGCTCGTGCCCCTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 152
904775087_904775095 -7 Left 904775087 1:32901431-32901453 CCGGCCCCGCAGCGCCCCCGCGG 0: 1
1: 0
2: 5
3: 82
4: 676
Right 904775095 1:32901447-32901469 CCCGCGGCTCGTGCCCCTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 152
904775078_904775095 12 Left 904775078 1:32901412-32901434 CCGTCACCCCCCGGGCCGCCCGG 0: 1
1: 1
2: 4
3: 29
4: 405
Right 904775095 1:32901447-32901469 CCCGCGGCTCGTGCCCCTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 152
904775086_904775095 -6 Left 904775086 1:32901430-32901452 CCCGGCCCCGCAGCGCCCCCGCG 0: 1
1: 0
2: 6
3: 75
4: 711
Right 904775095 1:32901447-32901469 CCCGCGGCTCGTGCCCCTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 152
904775081_904775095 5 Left 904775081 1:32901419-32901441 CCCCCGGGCCGCCCGGCCCCGCA 0: 1
1: 2
2: 2
3: 56
4: 566
Right 904775095 1:32901447-32901469 CCCGCGGCTCGTGCCCCTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 152
904775080_904775095 6 Left 904775080 1:32901418-32901440 CCCCCCGGGCCGCCCGGCCCCGC 0: 1
1: 2
2: 23
3: 188
4: 1112
Right 904775095 1:32901447-32901469 CCCGCGGCTCGTGCCCCTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 152
904775072_904775095 21 Left 904775072 1:32901403-32901425 CCTCCCTTCCCGTCACCCCCCGG 0: 1
1: 0
2: 1
3: 38
4: 437
Right 904775095 1:32901447-32901469 CCCGCGGCTCGTGCCCCTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 152
904775082_904775095 4 Left 904775082 1:32901420-32901442 CCCCGGGCCGCCCGGCCCCGCAG 0: 1
1: 1
2: 10
3: 71
4: 509
Right 904775095 1:32901447-32901469 CCCGCGGCTCGTGCCCCTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 152
904775075_904775095 18 Left 904775075 1:32901406-32901428 CCCTTCCCGTCACCCCCCGGGCC 0: 1
1: 0
2: 2
3: 17
4: 340
Right 904775095 1:32901447-32901469 CCCGCGGCTCGTGCCCCTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 152
904775085_904775095 -3 Left 904775085 1:32901427-32901449 CCGCCCGGCCCCGCAGCGCCCCC 0: 1
1: 1
2: 17
3: 194
4: 1460
Right 904775095 1:32901447-32901469 CCCGCGGCTCGTGCCCCTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 152
904775070_904775095 30 Left 904775070 1:32901394-32901416 CCGGACCGGCCTCCCTTCCCGTC 0: 1
1: 0
2: 2
3: 29
4: 303
Right 904775095 1:32901447-32901469 CCCGCGGCTCGTGCCCCTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 152
904775076_904775095 17 Left 904775076 1:32901407-32901429 CCTTCCCGTCACCCCCCGGGCCG 0: 1
1: 0
2: 2
3: 13
4: 188
Right 904775095 1:32901447-32901469 CCCGCGGCTCGTGCCCCTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 152
904775071_904775095 25 Left 904775071 1:32901399-32901421 CCGGCCTCCCTTCCCGTCACCCC 0: 1
1: 0
2: 12
3: 108
4: 1214
Right 904775095 1:32901447-32901469 CCCGCGGCTCGTGCCCCTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 152
904775084_904775095 2 Left 904775084 1:32901422-32901444 CCGGGCCGCCCGGCCCCGCAGCG 0: 1
1: 1
2: 7
3: 73
4: 533
Right 904775095 1:32901447-32901469 CCCGCGGCTCGTGCCCCTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904775095 Original CRISPR CCCGCGGCTCGTGCCCCTCC CGG Intergenic