ID: 904775100

View in Genome Browser
Species Human (GRCh38)
Location 1:32901460-32901482
Sequence CCCCTCCCGGCCGGTCGGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 70}

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904775081_904775100 18 Left 904775081 1:32901419-32901441 CCCCCGGGCCGCCCGGCCCCGCA 0: 1
1: 2
2: 2
3: 56
4: 566
Right 904775100 1:32901460-32901482 CCCCTCCCGGCCGGTCGGACCGG 0: 1
1: 0
2: 1
3: 4
4: 70
904775077_904775100 26 Left 904775077 1:32901411-32901433 CCCGTCACCCCCCGGGCCGCCCG 0: 1
1: 0
2: 2
3: 19
4: 233
Right 904775100 1:32901460-32901482 CCCCTCCCGGCCGGTCGGACCGG 0: 1
1: 0
2: 1
3: 4
4: 70
904775084_904775100 15 Left 904775084 1:32901422-32901444 CCGGGCCGCCCGGCCCCGCAGCG 0: 1
1: 1
2: 7
3: 73
4: 533
Right 904775100 1:32901460-32901482 CCCCTCCCGGCCGGTCGGACCGG 0: 1
1: 0
2: 1
3: 4
4: 70
904775086_904775100 7 Left 904775086 1:32901430-32901452 CCCGGCCCCGCAGCGCCCCCGCG 0: 1
1: 0
2: 6
3: 75
4: 711
Right 904775100 1:32901460-32901482 CCCCTCCCGGCCGGTCGGACCGG 0: 1
1: 0
2: 1
3: 4
4: 70
904775085_904775100 10 Left 904775085 1:32901427-32901449 CCGCCCGGCCCCGCAGCGCCCCC 0: 1
1: 1
2: 17
3: 194
4: 1460
Right 904775100 1:32901460-32901482 CCCCTCCCGGCCGGTCGGACCGG 0: 1
1: 0
2: 1
3: 4
4: 70
904775091_904775100 0 Left 904775091 1:32901437-32901459 CCGCAGCGCCCCCGCGGCTCGTG 0: 1
1: 0
2: 1
3: 7
4: 114
Right 904775100 1:32901460-32901482 CCCCTCCCGGCCGGTCGGACCGG 0: 1
1: 0
2: 1
3: 4
4: 70
904775089_904775100 2 Left 904775089 1:32901435-32901457 CCCCGCAGCGCCCCCGCGGCTCG 0: 1
1: 0
2: 1
3: 18
4: 197
Right 904775100 1:32901460-32901482 CCCCTCCCGGCCGGTCGGACCGG 0: 1
1: 0
2: 1
3: 4
4: 70
904775094_904775100 -10 Left 904775094 1:32901447-32901469 CCCGCGGCTCGTGCCCCTCCCGG 0: 1
1: 0
2: 0
3: 17
4: 175
Right 904775100 1:32901460-32901482 CCCCTCCCGGCCGGTCGGACCGG 0: 1
1: 0
2: 1
3: 4
4: 70
904775080_904775100 19 Left 904775080 1:32901418-32901440 CCCCCCGGGCCGCCCGGCCCCGC 0: 1
1: 2
2: 23
3: 188
4: 1112
Right 904775100 1:32901460-32901482 CCCCTCCCGGCCGGTCGGACCGG 0: 1
1: 0
2: 1
3: 4
4: 70
904775082_904775100 17 Left 904775082 1:32901420-32901442 CCCCGGGCCGCCCGGCCCCGCAG 0: 1
1: 1
2: 10
3: 71
4: 509
Right 904775100 1:32901460-32901482 CCCCTCCCGGCCGGTCGGACCGG 0: 1
1: 0
2: 1
3: 4
4: 70
904775087_904775100 6 Left 904775087 1:32901431-32901453 CCGGCCCCGCAGCGCCCCCGCGG 0: 1
1: 0
2: 5
3: 82
4: 676
Right 904775100 1:32901460-32901482 CCCCTCCCGGCCGGTCGGACCGG 0: 1
1: 0
2: 1
3: 4
4: 70
904775092_904775100 -8 Left 904775092 1:32901445-32901467 CCCCCGCGGCTCGTGCCCCTCCC 0: 1
1: 0
2: 4
3: 20
4: 353
Right 904775100 1:32901460-32901482 CCCCTCCCGGCCGGTCGGACCGG 0: 1
1: 0
2: 1
3: 4
4: 70
904775076_904775100 30 Left 904775076 1:32901407-32901429 CCTTCCCGTCACCCCCCGGGCCG 0: 1
1: 0
2: 2
3: 13
4: 188
Right 904775100 1:32901460-32901482 CCCCTCCCGGCCGGTCGGACCGG 0: 1
1: 0
2: 1
3: 4
4: 70
904775090_904775100 1 Left 904775090 1:32901436-32901458 CCCGCAGCGCCCCCGCGGCTCGT 0: 1
1: 0
2: 1
3: 9
4: 123
Right 904775100 1:32901460-32901482 CCCCTCCCGGCCGGTCGGACCGG 0: 1
1: 0
2: 1
3: 4
4: 70
904775093_904775100 -9 Left 904775093 1:32901446-32901468 CCCCGCGGCTCGTGCCCCTCCCG 0: 1
1: 0
2: 0
3: 18
4: 154
Right 904775100 1:32901460-32901482 CCCCTCCCGGCCGGTCGGACCGG 0: 1
1: 0
2: 1
3: 4
4: 70
904775083_904775100 16 Left 904775083 1:32901421-32901443 CCCGGGCCGCCCGGCCCCGCAGC 0: 1
1: 0
2: 10
3: 131
4: 740
Right 904775100 1:32901460-32901482 CCCCTCCCGGCCGGTCGGACCGG 0: 1
1: 0
2: 1
3: 4
4: 70
904775078_904775100 25 Left 904775078 1:32901412-32901434 CCGTCACCCCCCGGGCCGCCCGG 0: 1
1: 1
2: 4
3: 29
4: 405
Right 904775100 1:32901460-32901482 CCCCTCCCGGCCGGTCGGACCGG 0: 1
1: 0
2: 1
3: 4
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904775100 Original CRISPR CCCCTCCCGGCCGGTCGGAC CGG Intergenic