ID: 904775106

View in Genome Browser
Species Human (GRCh38)
Location 1:32901475-32901497
Sequence CGGACCGGCTGAGCAGCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 97}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904775086_904775106 22 Left 904775086 1:32901430-32901452 CCCGGCCCCGCAGCGCCCCCGCG 0: 1
1: 0
2: 6
3: 75
4: 711
Right 904775106 1:32901475-32901497 CGGACCGGCTGAGCAGCCCATGG 0: 1
1: 0
2: 0
3: 6
4: 97
904775101_904775106 -9 Left 904775101 1:32901461-32901483 CCCTCCCGGCCGGTCGGACCGGC 0: 1
1: 0
2: 0
3: 1
4: 52
Right 904775106 1:32901475-32901497 CGGACCGGCTGAGCAGCCCATGG 0: 1
1: 0
2: 0
3: 6
4: 97
904775099_904775106 -8 Left 904775099 1:32901460-32901482 CCCCTCCCGGCCGGTCGGACCGG 0: 1
1: 0
2: 0
3: 1
4: 65
Right 904775106 1:32901475-32901497 CGGACCGGCTGAGCAGCCCATGG 0: 1
1: 0
2: 0
3: 6
4: 97
904775094_904775106 5 Left 904775094 1:32901447-32901469 CCCGCGGCTCGTGCCCCTCCCGG 0: 1
1: 0
2: 0
3: 17
4: 175
Right 904775106 1:32901475-32901497 CGGACCGGCTGAGCAGCCCATGG 0: 1
1: 0
2: 0
3: 6
4: 97
904775084_904775106 30 Left 904775084 1:32901422-32901444 CCGGGCCGCCCGGCCCCGCAGCG 0: 1
1: 1
2: 7
3: 73
4: 533
Right 904775106 1:32901475-32901497 CGGACCGGCTGAGCAGCCCATGG 0: 1
1: 0
2: 0
3: 6
4: 97
904775090_904775106 16 Left 904775090 1:32901436-32901458 CCCGCAGCGCCCCCGCGGCTCGT 0: 1
1: 0
2: 1
3: 9
4: 123
Right 904775106 1:32901475-32901497 CGGACCGGCTGAGCAGCCCATGG 0: 1
1: 0
2: 0
3: 6
4: 97
904775091_904775106 15 Left 904775091 1:32901437-32901459 CCGCAGCGCCCCCGCGGCTCGTG 0: 1
1: 0
2: 1
3: 7
4: 114
Right 904775106 1:32901475-32901497 CGGACCGGCTGAGCAGCCCATGG 0: 1
1: 0
2: 0
3: 6
4: 97
904775092_904775106 7 Left 904775092 1:32901445-32901467 CCCCCGCGGCTCGTGCCCCTCCC 0: 1
1: 0
2: 4
3: 20
4: 353
Right 904775106 1:32901475-32901497 CGGACCGGCTGAGCAGCCCATGG 0: 1
1: 0
2: 0
3: 6
4: 97
904775089_904775106 17 Left 904775089 1:32901435-32901457 CCCCGCAGCGCCCCCGCGGCTCG 0: 1
1: 0
2: 1
3: 18
4: 197
Right 904775106 1:32901475-32901497 CGGACCGGCTGAGCAGCCCATGG 0: 1
1: 0
2: 0
3: 6
4: 97
904775087_904775106 21 Left 904775087 1:32901431-32901453 CCGGCCCCGCAGCGCCCCCGCGG 0: 1
1: 0
2: 5
3: 82
4: 676
Right 904775106 1:32901475-32901497 CGGACCGGCTGAGCAGCCCATGG 0: 1
1: 0
2: 0
3: 6
4: 97
904775085_904775106 25 Left 904775085 1:32901427-32901449 CCGCCCGGCCCCGCAGCGCCCCC 0: 1
1: 1
2: 17
3: 194
4: 1460
Right 904775106 1:32901475-32901497 CGGACCGGCTGAGCAGCCCATGG 0: 1
1: 0
2: 0
3: 6
4: 97
904775096_904775106 4 Left 904775096 1:32901448-32901470 CCGCGGCTCGTGCCCCTCCCGGC 0: 1
1: 1
2: 5
3: 34
4: 234
Right 904775106 1:32901475-32901497 CGGACCGGCTGAGCAGCCCATGG 0: 1
1: 0
2: 0
3: 6
4: 97
904775102_904775106 -10 Left 904775102 1:32901462-32901484 CCTCCCGGCCGGTCGGACCGGCT 0: 1
1: 0
2: 0
3: 5
4: 136
Right 904775106 1:32901475-32901497 CGGACCGGCTGAGCAGCCCATGG 0: 1
1: 0
2: 0
3: 6
4: 97
904775093_904775106 6 Left 904775093 1:32901446-32901468 CCCCGCGGCTCGTGCCCCTCCCG 0: 1
1: 0
2: 0
3: 18
4: 154
Right 904775106 1:32901475-32901497 CGGACCGGCTGAGCAGCCCATGG 0: 1
1: 0
2: 0
3: 6
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904775106 Original CRISPR CGGACCGGCTGAGCAGCCCA TGG Intergenic