ID: 904775381

View in Genome Browser
Species Human (GRCh38)
Location 1:32902794-32902816
Sequence CGCTGTGTGTGTTGGGCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 230}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904775375_904775381 22 Left 904775375 1:32902749-32902771 CCACTGTCTGTGTGTCTTTCTGC 0: 1
1: 2
2: 8
3: 137
4: 924
Right 904775381 1:32902794-32902816 CGCTGTGTGTGTTGGGCAGTTGG 0: 1
1: 0
2: 1
3: 20
4: 230
904775377_904775381 -4 Left 904775377 1:32902775-32902797 CCTGTGCTGACACCTGCGGCGCT 0: 1
1: 0
2: 0
3: 7
4: 77
Right 904775381 1:32902794-32902816 CGCTGTGTGTGTTGGGCAGTTGG 0: 1
1: 0
2: 1
3: 20
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904775381 Original CRISPR CGCTGTGTGTGTTGGGCAGT TGG Intergenic
900760404 1:4466719-4466741 CACTGTGTCTGCAGGGCAGTAGG - Intergenic
901103103 1:6734526-6734548 CTCAGTGTGTGTTGGCAAGTTGG - Intergenic
901227055 1:7619609-7619631 CATTGTGTGTGTTTGGCAGGGGG - Intronic
901310165 1:8263298-8263320 GTGTGTGTGTGTTGGGCGGTGGG - Intergenic
903320040 1:22537589-22537611 CGAAGTGTGTGATGGGAAGTGGG - Intergenic
904287835 1:29463531-29463553 CTGTGTGTGTGGTGGGCAGGGGG - Intergenic
904326359 1:29729124-29729146 TGCCGTGTGTGGTGGGCAGGAGG - Intergenic
904611542 1:31728568-31728590 CCATGTGTGTGCTGGGCGGTGGG - Intronic
904613385 1:31737168-31737190 CTGGGTGTGTGTTGGGCAGGTGG - Intronic
904775381 1:32902794-32902816 CGCTGTGTGTGTTGGGCAGTTGG + Intergenic
904808763 1:33149956-33149978 CCATGTTTGTGTTGGGCAGGTGG + Intronic
904978985 1:34480467-34480489 AGCAGTGTGTGTTGGGGGGTGGG - Intergenic
906201760 1:43965087-43965109 AGGTGTGTGTGTTGGGTTGTCGG + Intronic
906832984 1:49053094-49053116 TGCTGTGTGTGATGGATAGTTGG + Intronic
907250992 1:53139418-53139440 CCCTGTGTGTGTTGGGGAGAGGG - Intronic
907683005 1:56581384-56581406 TGCTGTGTGTGATTTGCAGTTGG - Intronic
908098200 1:60762814-60762836 GGCTGTGTGTGGTGGGAAGAGGG + Intergenic
912503403 1:110137434-110137456 TGCTGGGTGTGTTGGGAATTTGG + Intergenic
914220108 1:145673618-145673640 GGCTGTGTTTGTTGGGCTGCTGG + Intronic
914472689 1:147996484-147996506 GGCTGTGTTTGTTGGGCTGCTGG + Intergenic
915172386 1:153986955-153986977 GGCTGTGTGTGTTGGGGTGGTGG - Intergenic
915635772 1:157185524-157185546 TGCTGTGTGTGGTGAGCAGGTGG - Intergenic
918395590 1:184110696-184110718 CTCTGTGTGTGGTGGGTTGTGGG - Intergenic
919077409 1:192830384-192830406 CGCTGGGCCTGTTGGGCAGTGGG + Intergenic
920174255 1:204090212-204090234 GAATGTGTGTGTTGGGCAGTCGG + Intronic
921581904 1:216905166-216905188 TTCTGTGTGTGATGGGCAGCCGG - Intronic
922574791 1:226654530-226654552 GGCTCTGTGTGTTGAGCAGGAGG - Intronic
1062831386 10:608252-608274 GGCTGTGTGTGGGGGGCTGTGGG - Intronic
1063377946 10:5565333-5565355 CGGTGTGAGTATTGGGCAGGAGG + Intergenic
1063496344 10:6512688-6512710 AGCTTTGTGTGTTGGACAGAAGG - Intronic
1064970539 10:21061990-21062012 CATTGTGCGTGTTGGGCAGTAGG - Intronic
1066164507 10:32772151-32772173 CCCTGTGGGTGTTGGGGAATGGG + Intronic
1066541380 10:36450387-36450409 GACTGTGTGTGTTGGGGTGTGGG - Intergenic
1068221133 10:54047356-54047378 TGCTGTGTGTGGTGGGGGGTGGG + Intronic
1068506431 10:57905796-57905818 CAGTGTGAGTGATGGGCAGTGGG - Intergenic
1069057345 10:63858047-63858069 CGTTGTGCCTGATGGGCAGTTGG + Intergenic
1071231934 10:83598054-83598076 GGCTGTGTGTGTGTGGCACTGGG + Intergenic
1073031005 10:100525594-100525616 CGCTTTGGGTGGTGGGAAGTTGG - Intronic
1074083085 10:110183220-110183242 CAGTGTGTGTGTTGGGGAGAAGG + Intergenic
1074620534 10:115115219-115115241 AGCTGTGGGTGGTGGTCAGTTGG + Intronic
1075323592 10:121512019-121512041 CGCTGTGTGTGTATGGGTGTTGG + Intronic
1075944538 10:126421178-126421200 TGGAGTGTGTGTTGGGCAGGGGG - Intergenic
1077331374 11:1985154-1985176 CTCTGTCTGTGCTGGGGAGTGGG + Intergenic
1077445316 11:2588012-2588034 CGCAGTGGGTGGTGAGCAGTGGG + Intronic
1077477181 11:2795961-2795983 CCCTGTGTGAGTGGGGCAGGGGG - Intronic
1077851484 11:6077841-6077863 GGCTGTGTGAGTTGGGCCGTGGG - Intergenic
1084547256 11:69820603-69820625 CCCTGTGTGTATTGGGCCATGGG - Intergenic
1085196289 11:74673896-74673918 CTTTGTGTGTGTTGGGTAGGGGG - Intergenic
1085413922 11:76307733-76307755 CTGTGTGTGTGTTGGGAGGTGGG - Intergenic
1086253238 11:84842883-84842905 TGCTGTGTGTGTTGGGGTTTGGG - Intronic
1086737044 11:90319861-90319883 TGGTGTGTGTGTTGGGTAGGTGG - Intergenic
1088972556 11:114786772-114786794 GGCTGTCTGTGTGGGGCAGCTGG - Intergenic
1089344179 11:117779605-117779627 TGCTGTGTGTGGTGGGAGGTTGG - Intronic
1202814355 11_KI270721v1_random:40330-40352 CTCTGTCTGTGCTGGGGAGTGGG + Intergenic
1091490401 12:927490-927512 CCCTTTGTGTGTTGGGAAGTTGG - Intronic
1093467248 12:19462200-19462222 AGCTGTGTGTGTGGGGGTGTGGG + Intronic
1095207164 12:39451435-39451457 TGGTGTGTGTGTTGGGAAGTAGG - Intergenic
1101093635 12:101313710-101313732 GGGTGTGTGTGGTGGGGAGTGGG + Intronic
1101414342 12:104496194-104496216 CTGTGTGTGTGTGTGGCAGTGGG + Intronic
1101610575 12:106287695-106287717 GGGTGTGTGTGTTGGGAGGTAGG + Intronic
1103454103 12:121051224-121051246 AGCACTGTGTGTTAGGCAGTGGG + Intergenic
1104927135 12:132319686-132319708 AGCTGTGTGTGTGGCGGAGTGGG - Intronic
1104969002 12:132522782-132522804 CAGTGTGTGTGCTGGGCCGTTGG + Intronic
1106522686 13:30511811-30511833 AGGTGTGTGTTTGGGGCAGTGGG - Intronic
1107493691 13:40903774-40903796 TGCTGTGTGTATTGTGCAGTGGG - Intergenic
1108019508 13:46112450-46112472 CTATGTGTGTGTTGGGGGGTGGG + Intergenic
1112487737 13:99834998-99835020 CACTGTGTGTGTTAGGAAGAGGG - Intronic
1113104153 13:106755048-106755070 AGCTGTGTTTGAGGGGCAGTTGG + Intergenic
1113201329 13:107868820-107868842 CGCTGTGGGTGTTGGGGATGCGG + Intergenic
1113263996 13:108596088-108596110 AGCTGTGTGTGTTGAGAGGTGGG + Intergenic
1114261773 14:21042292-21042314 CGCTGTGTCTGTTTGGGGGTGGG - Exonic
1115497857 14:34024860-34024882 GGGTGTGTGTGTTGGGGAGGTGG - Intronic
1118718000 14:68573938-68573960 TGCTGTGTGTGTGGGGGTGTGGG + Intronic
1119111135 14:71975272-71975294 CATTGTTTCTGTTGGGCAGTTGG + Intronic
1120233544 14:81865398-81865420 CGCTGTGTGAGTTGGAGAGTAGG + Intergenic
1121455939 14:94038896-94038918 CTCTGTGTGGTTTGGGCACTGGG - Intronic
1122630810 14:103107011-103107033 GGGTGTGTGTGTAGGGTAGTGGG + Intronic
1123675476 15:22706975-22706997 AGCTGTGTGTGTATGGGAGTAGG + Intergenic
1124327469 15:28779921-28779943 AGCTGTGTGTGTAAGGGAGTAGG + Intergenic
1124769178 15:32515765-32515787 AGCTGTGTGTGTATGGGAGTAGG - Intergenic
1127289000 15:57553944-57553966 CGCAGTGTGTGGTGGGCTGGAGG + Intergenic
1128130543 15:65224448-65224470 TAGTGTGTGTGATGGGCAGTGGG + Intergenic
1128570374 15:68729283-68729305 CGCAGTGTGTAATGGGCAGAGGG - Intergenic
1128650516 15:69409213-69409235 GTGTGTGTGTGTTGGGGAGTTGG - Intergenic
1128677955 15:69625529-69625551 CTCTGTGTGTGCTGGCCACTCGG - Intergenic
1129702505 15:77775868-77775890 CTGCGTGTGTGTGGGGCAGTGGG - Intronic
1130563210 15:84974777-84974799 TGCTCGGTGTGTTGGGGAGTCGG + Intergenic
1130977236 15:88786462-88786484 CTGTGTGTGTGTTGGGGAGAGGG - Intergenic
1131429240 15:92373152-92373174 CAGTGTGTGTGTTGGGCGGGGGG + Intergenic
1133420078 16:5638518-5638540 CACTGTGTTTGTTGGGGACTGGG - Intergenic
1135771540 16:25221648-25221670 GGGTGTGTGTGTGGGACAGTGGG + Intronic
1136273782 16:29165943-29165965 TGCTGTGTGAGTTGAGCACTGGG + Intergenic
1137731279 16:50692607-50692629 ATGTGTGTGTGTTGGGAAGTGGG + Intergenic
1138125567 16:54435705-54435727 AGCTGGGTGTGTTGGGAAGCTGG + Intergenic
1139479998 16:67225516-67225538 TGCTGTGTGCGTAGGGCAATGGG - Intronic
1140481047 16:75263088-75263110 CGCCCTGTGTGCTGGGCACTGGG - Intronic
1141408160 16:83812764-83812786 TGCAGTGTGTGTGGGGCATTCGG - Exonic
1142077325 16:88127688-88127710 CGCTGTGTGAGTTGAGCACTGGG + Intergenic
1142153692 16:88523711-88523733 CTCTGAGAGTGTTTGGCAGTGGG + Intronic
1142221703 16:88858075-88858097 CCCTGTGTGTGTTCAGCACTGGG - Intronic
1142943329 17:3402230-3402252 TGCTGGGTGAGTTGGGCAGAAGG - Intergenic
1143089672 17:4442006-4442028 GTGTGTGTGTGTTTGGCAGTAGG + Intronic
1144426263 17:15145106-15145128 CTCTGTGTGTGTGGGGGAGGGGG - Intergenic
1149546432 17:57507163-57507185 CTCTGTGTGTGTTGGGGGGGGGG + Intronic
1151508912 17:74546447-74546469 CGCTGTGTGTGTAGGTCTGGGGG - Intergenic
1151586551 17:75012382-75012404 TGCTGTTTGAATTGGGCAGTGGG + Intergenic
1153739712 18:8111123-8111145 CTCTGTGTGTGTTGGGCACCTGG + Intronic
1153923441 18:9811539-9811561 AGCTGTTTTTATTGGGCAGTGGG - Intronic
1155073858 18:22338490-22338512 TGCTCTGTGTGTTAGGTAGTGGG + Intergenic
1157765143 18:50290904-50290926 TACTGTGAGTGTTGGGCTGTGGG + Intergenic
1158010850 18:52725527-52725549 GGCAGTGTGTGATAGGCAGTGGG + Intronic
1158280731 18:55822874-55822896 TGTTGTGTGTGTTCGGCAGGAGG - Intergenic
1158573309 18:58614908-58614930 GGCTGTGTGTGTTGGGGGGGAGG - Intronic
1161224464 19:3136614-3136636 GGCGGTGGGTGGTGGGCAGTGGG + Intronic
1161234475 19:3191001-3191023 CGCGGTGTGTGGCGGGCAGCAGG + Intronic
1161234487 19:3191063-3191085 CGCGGTGTGTGGCGGGCAGCAGG + Intronic
1161921425 19:7269061-7269083 TGGTGTGTGTGTTGGGGAGGCGG - Intronic
1164051248 19:21586983-21587005 CGCAGTGGCTGGTGGGCAGTGGG + Intergenic
1165483614 19:36081832-36081854 GGCTGGGTGTGTTGGGCTGCCGG - Intronic
1165579760 19:36851720-36851742 CTCTGTAGGTGATGGGCAGTAGG + Exonic
1166000289 19:39873534-39873556 CGCTGTGAGTGTGGGCCAGGTGG - Exonic
1167637067 19:50661484-50661506 AGCTGTGTGTGCTGGGGAGAGGG + Intronic
1167793772 19:51695923-51695945 CTCTGTGCCTGTTGGGCGGTGGG + Intergenic
1168124603 19:54276500-54276522 AGCTGTGTGTGCAGGGCAGGGGG - Intronic
1168177384 19:54635038-54635060 AGCTGTGTGTGCAGGGCAGGGGG + Intronic
925778417 2:7357140-7357162 CCCTGTGTGTGTTCAGCAGGTGG + Intergenic
926820753 2:16849101-16849123 CCATGTGGGTGTTGGGCAGGTGG - Intergenic
928402809 2:30991527-30991549 CGCTCTGGGTCTTTGGCAGTAGG + Intronic
930304540 2:49661970-49661992 CATTATGTGTGTTGAGCAGTTGG + Intergenic
932414598 2:71566001-71566023 GTGTGTGTGTGTTGGGCAGCAGG + Intronic
933933662 2:87181147-87181169 AGCTGGGTGTGTTCGGGAGTTGG + Intergenic
935225426 2:101048094-101048116 CCCTGTGTGTGTGGGGCACATGG - Intronic
936165406 2:110115854-110115876 CGATGGGTGTGTCGGGCAGGAGG - Exonic
938120153 2:128627325-128627347 ATCTGTGTGTGTTGGGAAGCGGG + Intergenic
941377363 2:164748023-164748045 AGCTGTGTGTGGTGGGGAGCAGG + Intronic
945268892 2:207918993-207919015 AGGCGTGTGTGGTGGGCAGTGGG + Intronic
946368940 2:219268476-219268498 CCTAGTGTGTGTTAGGCAGTGGG + Intronic
946975418 2:225142869-225142891 GGTTGTGTGTGTTGGGGGGTGGG + Intergenic
947365860 2:229394355-229394377 CTGTCTGTGTCTTGGGCAGTGGG - Intronic
948229828 2:236341744-236341766 TGCTGTGTGTGGTGGGGAGAAGG + Intronic
948454131 2:238096924-238096946 CACTGGGTGTGGTGGGCAGGCGG + Intronic
949023915 2:241756039-241756061 CCCTGTGTGTGCTGGGTGGTGGG + Intronic
949050836 2:241896547-241896569 GGGTGTGTGTGTTGGGGTGTGGG + Intronic
949050897 2:241896716-241896738 GGGTGTGTGTGTTGGGGTGTGGG + Intronic
1168974174 20:1951767-1951789 GGCTGTGTGAGCTGGGCAGGAGG - Intergenic
1169410118 20:5361653-5361675 AGCTGTGTGTTTTGGGCAAACGG + Intergenic
1170476974 20:16725114-16725136 GTGTGTGTGTGTTGGGCAGGAGG + Intergenic
1171426028 20:25049275-25049297 CTCTGTGTGTGTTGGGGAGCTGG + Intronic
1172282818 20:33720078-33720100 GGCTGTGTGAGTGGGGCCGTCGG - Exonic
1174082746 20:47982820-47982842 CGCAGTGGGTGGTGGGCAGGGGG - Intergenic
1175717964 20:61268126-61268148 CTCTTTCTGTGTTGGGCAGCTGG + Intronic
1175719976 20:61280022-61280044 AGCTGTGTGGGTGGGGCAGGCGG + Intronic
1175988472 20:62776120-62776142 AGCTGTGGGTGCTGGGCAGGTGG - Intergenic
1178286520 21:31329946-31329968 GGCTGTGCGTGTGGGGCAGGAGG - Intronic
1178365594 21:31986635-31986657 CGCTGTGTGTGTGGGCCATGTGG - Intronic
1178938992 21:36889320-36889342 CGCAGTGTGTGGTGAGCAGATGG - Intronic
1180599693 22:17007924-17007946 CTCTTTGTGAGTGGGGCAGTGGG - Exonic
1181035109 22:20166180-20166202 CCCCGTGTGTGTTGGGGAGGTGG - Intergenic
949119945 3:373411-373433 CAGTGGGTGTGTTGGGCTGTGGG + Intronic
950214071 3:11145448-11145470 CACTGTGTGTGGGGTGCAGTAGG - Intronic
952027415 3:29099777-29099799 CCCTGTGTGTGTTGGGGGATGGG + Intergenic
952956642 3:38561941-38561963 CTCTGTCTGTGATGGCCAGTGGG - Intronic
953521475 3:43647313-43647335 AGTGGTGTGTGTTGGGGAGTTGG + Intronic
955092859 3:55769447-55769469 CTCTGTCTGGGTTGGGCAGAAGG + Intronic
955472520 3:59300734-59300756 CCCTGTGAGTGTTGGGGAGGTGG + Intergenic
956491281 3:69774708-69774730 CCCTGTGTATGTTGGGGTGTGGG + Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957132038 3:76235281-76235303 CCCTGTGTGTGTTGGGCGGTGGG - Intronic
957181339 3:76882059-76882081 CACTGTGTCTGTTGGGTCGTAGG + Intronic
959018680 3:101164933-101164955 CCCAGTGTGTGAGGGGCAGTCGG + Intergenic
961591395 3:127984401-127984423 AGCAGTGTGTGCTGGGCACTGGG + Exonic
961630769 3:128296821-128296843 CTCTGCGTGTGTTGGCCAGAAGG + Intronic
961869932 3:129979993-129980015 CCGTGTGTGTGTTGGGGAGAAGG - Intergenic
962155547 3:132945254-132945276 AGCTGTGTGTGTTGGGGGGGTGG + Intergenic
962890755 3:139670749-139670771 AACTGTGTGTGTTGGGTTGTGGG + Intronic
964656708 3:159074982-159075004 CCCTTTGTTAGTTGGGCAGTGGG - Intronic
965263331 3:166510804-166510826 CAGTGGGTGTGTTGGGCTGTGGG - Intergenic
966148883 3:176844225-176844247 TTTTGTGTGTGTTGGGAAGTTGG + Intergenic
969276770 4:6141049-6141071 CGCTGTGAATGCTGGGCAGGGGG - Intronic
969278691 4:6154604-6154626 GGCTGTGCGTGTTGGGCTCTTGG - Intronic
971630469 4:28986929-28986951 GGCTGTGTGTGTTGGGGGGCAGG - Intergenic
971713001 4:30141319-30141341 TGTTGTGTGTGTGGGGCAGGGGG + Intergenic
972305441 4:37826113-37826135 AGCTGTGTGTGATGGGAGGTAGG + Intergenic
972936336 4:44140569-44140591 TGCTGAGTGTATTGTGCAGTAGG - Intergenic
974271466 4:59656289-59656311 CTTCCTGTGTGTTGGGCAGTGGG - Intergenic
974389327 4:61245042-61245064 TGGTGAGTGGGTTGGGCAGTAGG + Intronic
977310558 4:95381907-95381929 AGGTGTGTGTATGGGGCAGTTGG + Intronic
978328388 4:107585175-107585197 CACTGGGTCTGTTGGGCAGGGGG + Intergenic
980887226 4:138776224-138776246 GGGTGTGTGTGTTGGGGCGTGGG - Intergenic
982633635 4:157864823-157864845 CTCTGTGTGTGTGTGGCAGTTGG + Intergenic
983037824 4:162888960-162888982 ATATGTGTGTGTTGGGCAATAGG - Intergenic
984199379 4:176698580-176698602 TACTGTGTGTGTGGGGGAGTTGG + Intronic
985519427 5:366068-366090 CAGTGTGTGTGTGGGGCAGGGGG - Intronic
985587955 5:750708-750730 CGCTGAGGGTGCTGGGCTGTAGG - Intronic
985602624 5:843175-843197 CGCTGAGGGTGCTGGGCTGTAGG - Intronic
987834730 5:23146348-23146370 AGCTTAGTGTGTTAGGCAGTTGG + Intergenic
988990115 5:36662319-36662341 CAAAGTGTGTGTTGGGCAGTGGG - Intronic
997844332 5:137272739-137272761 CCGTGTGTGTGTTGGGGGGTGGG - Intronic
999295611 5:150457944-150457966 CGGTGTGTGTGTTGGGGATTAGG + Intergenic
1002642725 5:180638106-180638128 AGCACTGTGTGTTGGGCAGAGGG - Intronic
1003572212 6:7263136-7263158 CACTGTGTGTTCTGGGCAGTGGG - Intergenic
1005085607 6:22003559-22003581 CACTGTGTGTGTAGAGCTGTTGG - Intergenic
1006295758 6:33169364-33169386 CCCTGTGAGTTTGGGGCAGTGGG - Exonic
1006898189 6:37484003-37484025 CCCTGTCTGTGCTGGGCAGTGGG + Intronic
1007160477 6:39787829-39787851 AGCTGTGTGTGTTGGGTGGAGGG + Intergenic
1007507984 6:42351812-42351834 CCCTGTGTCTGTTTGGCAGATGG - Intronic
1009032846 6:58081248-58081270 CTGTGTGTGTGTTAGCCAGTGGG - Intergenic
1009208462 6:60833022-60833044 CTGTGTGTGTGTTAGCCAGTGGG - Intergenic
1010384792 6:75267478-75267500 CGTTTTGTGTGTTTGGCTGTTGG - Intronic
1011327973 6:86172046-86172068 GCCTGTGTGTCCTGGGCAGTAGG + Intergenic
1013194487 6:107833307-107833329 CGCTGTGTGTGTTGTTGGGTAGG + Intergenic
1015497415 6:133895785-133895807 CACTGTGTGCGTCGGGAAGTCGG + Intergenic
1017708566 6:157147060-157147082 CACAGTGTGTGCTGGGCACTTGG - Intronic
1018435987 6:163759424-163759446 AGCTGAGTGAGTTGGGGAGTGGG + Intergenic
1019001446 6:168756561-168756583 CTCTGTGTGTGTTGGGGCATGGG - Intergenic
1019104792 6:169659587-169659609 GGCTGTGTGTGGTGGGCTCTGGG - Intronic
1020123569 7:5519620-5519642 GGCTGACTGTGGTGGGCAGTGGG + Intergenic
1021691766 7:23237100-23237122 GTGTGTGTGTGTTGGGCAGCAGG - Intronic
1021993540 7:26158700-26158722 CACTGTGTGGGTTGAGAAGTAGG - Intronic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1024274910 7:47669690-47669712 TGCAGTGGGTGTTGGGCAGCAGG - Intergenic
1024392756 7:48834250-48834272 CTGTGTATGTGTTGGGGAGTAGG + Intergenic
1025850480 7:65239706-65239728 CGCGGTGTGTGGTGAGCAGCAGG - Intergenic
1028517721 7:91697046-91697068 GGGTGTATGTGTTGGGGAGTGGG - Intronic
1028903055 7:96122548-96122570 CACTATGTGTGTTGGGGGGTGGG + Intronic
1033092989 7:138404038-138404060 CGCGGTGGGCGGTGGGCAGTGGG + Intergenic
1037934098 8:22902926-22902948 CGCTGTAGGGGTTGGGGAGTGGG + Intronic
1038579857 8:28738618-28738640 TGCTCTGTGTGGTGGGCAGTGGG - Intronic
1038813842 8:30880780-30880802 AGCTGTGTGTTTTGGGGAGGGGG + Intronic
1041686161 8:60646591-60646613 ATCTGTGTGTTTTGGGCAGTGGG - Intergenic
1043826006 8:84929306-84929328 CAGTGGGTGTGTTGGGCTGTAGG - Intergenic
1047882586 8:129212692-129212714 GGATGTGTGTGTTGGGAAGAGGG + Intergenic
1048266893 8:132995284-132995306 TGCTGTATGTGGTGGGTAGTAGG - Intronic
1048396022 8:134014742-134014764 TGCTGTATGTGTTGGGCTCTGGG + Intergenic
1048498720 8:134956993-134957015 AGCTGAGGGTGTGGGGCAGTGGG + Intergenic
1048933117 8:139332297-139332319 GTGTGTGTGTGTTGGGCAGGGGG - Intergenic
1049057998 8:140254251-140254273 CCCTGTGTATCCTGGGCAGTGGG + Intronic
1049290379 8:141798485-141798507 CTCTGAGTGTGTGGGGGAGTGGG + Intergenic
1054923219 9:70562602-70562624 TTGTGTGTGTGTTGGGCAGGGGG + Intronic
1055000632 9:71446086-71446108 CGCTGTATATGTTAAGCAGTAGG + Intronic
1057820573 9:98327352-98327374 CGCTGTGGGTTTTGAGCAGGTGG - Intronic
1057849311 9:98552479-98552501 GGCTGTGTGTGTTGGGAACTCGG + Intronic
1059385114 9:113958553-113958575 GGCTCTGTGAGGTGGGCAGTGGG + Intronic
1062443654 9:136584434-136584456 GGCTGTGTGTGTGTGACAGTGGG - Intergenic
1062635556 9:137488756-137488778 TGCTGTGGGTGGTGGACAGTTGG - Intronic
1186619620 X:11224835-11224857 GGCTGTGTATGTTGGGAAGATGG + Intronic
1187038478 X:15567280-15567302 GTGTGTGTGTGTTGGGCAGGGGG - Intronic
1189297701 X:39930363-39930385 CTCTGTGTGTGCTGGACAGATGG + Intergenic
1192370893 X:70512095-70512117 AGCTTTGTGTGAGGGGCAGTGGG - Intergenic
1194948092 X:100092081-100092103 CCCTGTCTGTGATGAGCAGTGGG - Intergenic
1199600298 X:149537739-149537761 TCCTGGGTGTGCTGGGCAGTGGG - Intergenic
1199650286 X:149942201-149942223 TCCTGGGTGTGCTGGGCAGTGGG + Intergenic