ID: 904776553

View in Genome Browser
Species Human (GRCh38)
Location 1:32911877-32911899
Sequence GGGTACACACATTTGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904776553_904776558 15 Left 904776553 1:32911877-32911899 CCATGTTCCAAATGTGTGTACCC No data
Right 904776558 1:32911915-32911937 ATCTCTACCTGAATGCCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904776553 Original CRISPR GGGTACACACATTTGGAACA TGG (reversed) Intergenic
No off target data available for this crispr