ID: 904780032

View in Genome Browser
Species Human (GRCh38)
Location 1:32939472-32939494
Sequence ATGCATAATAATAAGTAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 218}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904780032_904780034 7 Left 904780032 1:32939472-32939494 CCTGCCTACTTATTATTATGCAT 0: 1
1: 0
2: 1
3: 16
4: 218
Right 904780034 1:32939502-32939524 TTGTCTGTTAACTCCACAAAAGG 0: 1
1: 0
2: 1
3: 11
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904780032 Original CRISPR ATGCATAATAATAAGTAGGC AGG (reversed) Intronic
904780032 1:32939472-32939494 ATGCATAATAATAAGTAGGCAGG - Intronic
907135512 1:52136289-52136311 AATAATAATAATAATTAGGCTGG + Intergenic
907825406 1:58011985-58012007 ATGCACAATAAAAAGATGGCTGG - Intronic
910556880 1:88544171-88544193 ATGCATACTGATAAGTGTGCTGG + Intergenic
911059198 1:93733302-93733324 ATCCAAAATACTAAGTAAGCCGG - Intronic
914699338 1:150117219-150117241 AATAATAATAATAAGTAGGGGGG + Intronic
915728952 1:158039163-158039185 ATGCAAAATCATAGGCAGGCTGG - Intronic
917529996 1:175826394-175826416 ATCAATAAGAATAAATAGGCTGG + Intergenic
919259061 1:195166167-195166189 ATGCATAAGCAGAATTAGGCAGG - Intergenic
923897447 1:238287524-238287546 TTGTATAATAATAAGTAGATGGG + Intergenic
1063742337 10:8837674-8837696 AAGCAAAATAACAGGTAGGCTGG - Intergenic
1064480625 10:15736919-15736941 ATACATGCAAATAAGTAGGCAGG + Intergenic
1065251977 10:23824331-23824353 ATACATAAAGATATGTAGGCCGG + Intronic
1068035623 10:51756517-51756539 ATTAAAAATAAAAAGTAGGCTGG + Intronic
1068292998 10:55030147-55030169 ATGAATACTCATATGTAGGCAGG + Intronic
1068663975 10:59653117-59653139 TTGGATAAGAATAAGCAGGCAGG + Intronic
1069436256 10:68386641-68386663 ATGTAAAAAAATGAGTAGGCCGG - Intronic
1069479893 10:68772173-68772195 ATGTATAATAATAATTAGGCTGG - Intronic
1073243255 10:102072060-102072082 ATTCACAATAATAATTAGGCTGG - Intergenic
1074251588 10:111756295-111756317 GTGCATAATTCTAAATAGGCAGG + Intergenic
1076039692 10:127234661-127234683 ATGCAAAAGAATAAATTGGCAGG + Intronic
1076336394 10:129709630-129709652 CTGCATAATCATATGGAGGCTGG + Intronic
1078304401 11:10169119-10169141 ATGCATAATAATCAGTAAATGGG + Intronic
1079771903 11:24473219-24473241 ATACAAAATAATAAGGAGGCAGG + Intergenic
1084740833 11:71138483-71138505 ATCCACAATAATAAGCAGACGGG + Intronic
1085118903 11:73954332-73954354 ATAAATAAAAAAAAGTAGGCCGG + Intronic
1085376453 11:76066768-76066790 ATTTATAAAAATAAATAGGCTGG - Intronic
1085995809 11:81912268-81912290 CTGTATAATAATAAGAAGGTAGG - Intergenic
1086923366 11:92612983-92613005 ATGCAGCATAATAGGTAGGACGG + Intronic
1087286266 11:96268176-96268198 ATACATCTTAAAAAGTAGGCTGG + Intronic
1090211788 11:124925902-124925924 AAGGATAATAATAACAAGGCTGG + Intronic
1092842489 12:12556409-12556431 ATAAATAATAATAATTAGCCGGG + Intronic
1097420870 12:59377483-59377505 ATGAACCATAATATGTAGGCTGG + Intergenic
1097944824 12:65355436-65355458 TTTCATAATCATAAGTTGGCTGG + Intronic
1098828632 12:75331079-75331101 ATACATAAAAATATTTAGGCCGG - Intronic
1099559448 12:84154184-84154206 AAACAAAATAATAAGTAGGTTGG - Intergenic
1099895863 12:88645711-88645733 ATAGAAAATAATAATTAGGCAGG - Intergenic
1100382271 12:94072974-94072996 ATGCTTAATAATCACTTGGCTGG - Intergenic
1100806172 12:98285922-98285944 AAGAATAAAAATAAGTAGCCTGG - Intergenic
1102276809 12:111588832-111588854 ATGCATAAAAAAAATTAGCCGGG + Intronic
1103434362 12:120913508-120913530 AATAATAATAATAAATAGGCCGG - Intergenic
1103692234 12:122784532-122784554 AATAATAATAATAATTAGGCTGG + Intronic
1103751833 12:123169336-123169358 ATGCAAAATAAAAATTAGCCAGG + Intronic
1103885824 12:124199330-124199352 ATGAAAAAGAATAAGGAGGCTGG - Intronic
1104200719 12:126585989-126586011 ATAAATAAAAATAAGTAGACCGG - Intergenic
1105809139 13:23979450-23979472 TTGCATATTCATAAGAAGGCGGG - Intergenic
1106370825 13:29130918-29130940 ACACATAAAAATAAATAGGCTGG - Intronic
1108061602 13:46538624-46538646 ATGCAAAAAAATAATTAGCCAGG + Intergenic
1108470616 13:50763226-50763248 ATTCATTGTAATAAGGAGGCTGG + Intronic
1108954412 13:56134673-56134695 ATGCATAAAAATAGGTAGAATGG - Intergenic
1113978402 13:114250194-114250216 ATAAAAAATAATAAATAGGCTGG + Intronic
1114166191 14:20220725-20220747 ATTAATAATAATAAGCAGGAAGG + Intergenic
1114881810 14:26795713-26795735 ATGCATACTATTAACTAGTCAGG - Intergenic
1115342780 14:32309922-32309944 ATGCAGAAAACTAAGCAGGCAGG - Intergenic
1116147347 14:41091525-41091547 ATGAATAATAATAAGGTGGGAGG - Intergenic
1116399327 14:44486144-44486166 TTGCATAGTAATAGGTAGACTGG - Intergenic
1116925333 14:50629007-50629029 TAGAATAATAAAAAGTAGGCTGG - Intronic
1118209974 14:63756784-63756806 ATGAAAAATAATGAGGAGGCTGG + Intergenic
1119106248 14:71927244-71927266 ATGCTTAATAATCAGAATGCAGG - Intergenic
1119737585 14:76993412-76993434 AATAATAATAATAAATAGGCCGG - Intergenic
1120444246 14:84573885-84573907 TTGCATAATAATAATAAGGTGGG - Intergenic
1120969496 14:90195544-90195566 ATGCAAAACAATAATTAGCCAGG + Intergenic
1122514393 14:102297059-102297081 AAAAATAATAATAAATAGGCTGG + Intronic
1122615532 14:103015323-103015345 GTGTATAAAAATAATTAGGCTGG + Intronic
1122703158 14:103603847-103603869 AATAATAATAATAAATAGGCTGG + Intronic
1125145812 15:36466948-36466970 AGGCATGACAATAAGTAGGTAGG - Intergenic
1125975232 15:43945203-43945225 GAGCATAATAAAAAGTAGGCAGG - Intronic
1127748861 15:62010767-62010789 ATGCATAATAATAAGCTCGATGG + Intronic
1128518565 15:68360326-68360348 ATGCATTATAATAATAAAGCTGG - Intronic
1130213018 15:81943759-81943781 AAGCAAAATAATAATAAGGCCGG + Intergenic
1131586336 15:93697928-93697950 AAGCTTAATAATAAGAAAGCTGG + Intergenic
1131808811 15:96151417-96151439 AAGTATCATAATAAGTAGGCCGG + Intergenic
1135329110 16:21546429-21546451 AAGAAAAATATTAAGTAGGCTGG + Intergenic
1135579262 16:23611440-23611462 AATAATAATAATAACTAGGCTGG - Intronic
1136162187 16:28427496-28427518 CTGAATAATAATAATTTGGCTGG - Intergenic
1136200778 16:28687494-28687516 CTGAATAATAATAATTTGGCTGG + Intergenic
1136217120 16:28801682-28801704 CTGAATAATAATAATTTGGCTGG + Intergenic
1136339451 16:29632373-29632395 AAGAAAAATATTAAGTAGGCTGG + Intergenic
1136869644 16:33794129-33794151 ATGCACAATTACAAGTAGACAGG + Intergenic
1137430028 16:48411200-48411222 ATAAATAATAATAAGAAGGCCGG - Intronic
1139537114 16:67583281-67583303 TTTCAAAATAAGAAGTAGGCTGG - Intronic
1140990886 16:80210329-80210351 ATGCAAAAAAAAAAGTAGGCTGG + Intergenic
1141724932 16:85781741-85781763 ATACAAATAAATAAGTAGGCTGG - Intronic
1203102528 16_KI270728v1_random:1321926-1321948 ATGCACAATTACAAGTAGACAGG - Intergenic
1146813593 17:35924058-35924080 AATAATAATAATAATTAGGCAGG + Intronic
1148064237 17:44857066-44857088 ACGCCTAATAAGAAGTAAGCTGG - Exonic
1150501663 17:65656993-65657015 GTGGCTATTAATAAGTAGGCTGG + Intronic
1150553136 17:66229231-66229253 ATCAATAATGATAAGTAGGCCGG - Intronic
1151592988 17:75058799-75058821 AAAAATAATAATAAATAGGCCGG + Intronic
1151753818 17:76059246-76059268 AAAAATAATAATAAGTAAGCCGG + Intronic
1153107739 18:1547412-1547434 ATGCATAATTAGAGGTGGGCAGG - Intergenic
1153230988 18:2935838-2935860 ATGTATAATAAAAAGTAGAGGGG + Intronic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1154144626 18:11856768-11856790 ATGCAAAAAAATAATTAGCCAGG + Intronic
1155469800 18:26179429-26179451 ATACATAAAAATCAGTAGACAGG - Intronic
1155677677 18:28449409-28449431 ATGCATAAAAATATGTTGGTAGG - Intergenic
1156365334 18:36420828-36420850 GTGCAGGATAATAAGTAGGAAGG + Intronic
1157728790 18:49986188-49986210 ATGCATGATAATAAGGAAACTGG - Intronic
1158496926 18:57964148-57964170 ATAAATAAAAATAAGTAAGCTGG + Intergenic
1158600491 18:58852174-58852196 TTGCATTATAATATGTAGGAAGG + Intergenic
1163245725 19:16092834-16092856 AAGCATAAAAAGAAGTAAGCAGG - Intronic
1163605545 19:18273326-18273348 AATAATAATAATAATTAGGCCGG - Intronic
1163651868 19:18522398-18522420 ATGTATAATACTATGGAGGCGGG - Intergenic
1165808857 19:38598325-38598347 ATATATAACAATAAATAGGCCGG - Intronic
1168574974 19:57501925-57501947 ATAAATAATAATATGTAGTCTGG - Intronic
929169414 2:38916707-38916729 AAGCAAAATAATAAGTTGGCAGG - Intronic
930610361 2:53536080-53536102 ATAAATAATAAAAAGTTGGCTGG - Intronic
931021620 2:58051139-58051161 ATAAAAAAAAATAAGTAGGCTGG - Intronic
933472373 2:82742197-82742219 ACGCAGAATAATAAATAAGCAGG - Intergenic
937555425 2:123148996-123149018 ATGAATCATAATAAATATGCTGG - Intergenic
939290369 2:140186596-140186618 ATGCGTAACAATGAGTAGCCAGG + Intergenic
939726901 2:145732019-145732041 AATAATAATAATAAGAAGGCAGG + Intergenic
940092262 2:149933909-149933931 AAGAATAATAATAACTTGGCTGG + Intergenic
942759407 2:179380620-179380642 ATGCAAAAAAATAATTAGCCAGG + Intergenic
943453533 2:188074943-188074965 ATGCATGCTAATAAGGTGGCAGG + Intergenic
944897048 2:204176004-204176026 AAGCATAATAATAAGCACCCGGG - Intergenic
946004203 2:216509086-216509108 ATACTTAAAAATAAGTAGGCTGG - Intronic
947970808 2:234322341-234322363 ATGCATAAAAAAAATTAGCCAGG + Intergenic
948259923 2:236596088-236596110 ATGCATTATAATAATTTGCCTGG - Intergenic
1170061472 20:12264082-12264104 ATGTATAATAATAATAATGCAGG + Intergenic
1173320162 20:41980500-41980522 ATGCAGAATAATATGGGGGCAGG - Intergenic
1173992423 20:47313633-47313655 AATAATAATAATAATTAGGCTGG + Intronic
1174437888 20:50524275-50524297 GTGCACAGTAATTAGTAGGCAGG + Intronic
1175852177 20:62099480-62099502 AGGCATTCTAATAAGTAGCCGGG - Intergenic
1177046561 21:16177825-16177847 ATGCTTACAAATAATTAGGCAGG + Intergenic
1178820230 21:35968106-35968128 AAAAATAATAATAATTAGGCAGG + Intronic
1180846783 22:18987316-18987338 ATACATATAAATAAGTAGGCTGG + Intergenic
1182709971 22:32315294-32315316 ATAAATAATAAAAAGTAGGAGGG + Intergenic
1183815635 22:40297824-40297846 AATAATAATAATAAATAGGCCGG + Intronic
1184006983 22:41717457-41717479 AAAAATAATAATAATTAGGCTGG - Intronic
1184791077 22:46700427-46700449 ATGCAAAATCAGAAGTAGGCCGG + Intronic
1184917848 22:47585127-47585149 GTTCATAATAATCAGTAGACAGG - Intergenic
949090791 3:26462-26484 ATTAATAATAATAATTAGCCAGG + Intergenic
949318058 3:2778682-2778704 ATGCATTATAATAAGTTGGATGG - Intronic
949429081 3:3953577-3953599 ATGCAAAATAATAAATATGATGG - Intronic
952151733 3:30600895-30600917 CTGCATAATAATAGGTGGGATGG - Intergenic
954306642 3:49729702-49729724 ATAAATAATAATAATAAGGCTGG - Intronic
956567280 3:70652939-70652961 AGGCATAATAAAAAGCAAGCAGG - Intergenic
956751980 3:72350857-72350879 ATGCATAAATAGAAGAAGGCAGG - Intergenic
956794827 3:72708494-72708516 ATGCATATTTATAATTAGACTGG - Intergenic
957031114 3:75242675-75242697 ATTAATAATAATAATTAGCCAGG + Intergenic
957232025 3:77531936-77531958 ATGCTTAATAATAAGTAAATGGG - Intronic
957989419 3:87610720-87610742 ATGCATAAAAACTAGTAAGCAGG - Intergenic
958941756 3:100324351-100324373 AAGCATTAAAATAAGTAGGTAGG + Exonic
963629464 3:147714526-147714548 ATGGATAATAATTTGTAGGGAGG - Intergenic
967755479 3:193163642-193163664 ATGCATCATAATTATTAGGTTGG - Intergenic
967782158 3:193451384-193451406 AGGCACAATAATCAGGAGGCTGG + Intronic
968413291 4:407242-407264 ATGCATATTAAGAATAAGGCGGG + Intergenic
968981971 4:3855156-3855178 ATGCATGATTGTAGGTAGGCTGG + Intergenic
971141901 4:23933709-23933731 ATGATTATTAATAAGTGGGCAGG - Intergenic
972160906 4:36226306-36226328 ATTCAAAATAGTAAGTATGCTGG - Intronic
972454094 4:39235424-39235446 ATTAAAAATAATAATTAGGCTGG - Intronic
973654065 4:53027529-53027551 ATATTTAATAAAAAGTAGGCTGG + Intronic
975134966 4:70865878-70865900 ATGCTTAATAATAAGTTGCAAGG + Intergenic
975244539 4:72104334-72104356 TTGCCTCATAATAAGTAGGAGGG + Intronic
975347310 4:73306930-73306952 ATGTCTAATAATAAGGAGGTTGG - Intergenic
976726243 4:88218233-88218255 ATGCATAGTAAGAAGTAATCAGG - Intronic
977129128 4:93211912-93211934 ATGAATGAGAATAAGTATGCGGG - Intronic
977325481 4:95570285-95570307 ATCAAAAATAATAACTAGGCTGG - Intergenic
978832607 4:113106905-113106927 AAGCAAAGTAATAAATAGGCAGG - Intronic
980367708 4:131827313-131827335 ATGCATAAAAATGAATAGACTGG + Intergenic
980752874 4:137115452-137115474 GTGCATAATAAAAATTTGGCTGG + Intergenic
983020250 4:162667817-162667839 ATGCAAAAGTATAAGAAGGCTGG + Intergenic
986972398 5:13352461-13352483 ATGAATCTTAATAAGTAGGATGG - Intergenic
987454978 5:18132507-18132529 ATACAAAATAAAAAATAGGCAGG - Intergenic
988696736 5:33628983-33629005 AGGCATTCTAATAAGTAGCCAGG - Intronic
992523394 5:77580657-77580679 ATAAAAAATAAAAAGTAGGCTGG + Intronic
993346077 5:86784211-86784233 ATAAATATTAATAATTAGGCAGG + Intergenic
995825444 5:116292521-116292543 ATGCAAAATAATGAGGTGGCAGG - Exonic
996502530 5:124232646-124232668 ATGAATAATAACAAGCAGACTGG + Intergenic
1000847458 5:166299642-166299664 AGGGATAATAATTAGGAGGCTGG - Intergenic
1001048908 5:168398514-168398536 ATGCAGAATAATCAGTAGCTAGG - Intronic
1002944536 6:1748968-1748990 AAGTATAATAATAAGTAGAAAGG - Intronic
1004711813 6:18178380-18178402 ATAAATAATAAAAAATAGGCCGG - Intronic
1005169165 6:22961880-22961902 ATGCATAATAAGTAATATGCAGG - Intergenic
1005827614 6:29644244-29644266 CTGAATAATTATAAGTAGGATGG + Intergenic
1006691092 6:35886374-35886396 ATGAAAAATACTGAGTAGGCCGG - Intronic
1007448541 6:41925657-41925679 ATAAATAAAAATAAATAGGCCGG - Intronic
1010353435 6:74903368-74903390 ATGCAGAACAATTAGAAGGCTGG + Intergenic
1011350800 6:86421602-86421624 ATTCATAATAATAACTGTGCAGG - Intergenic
1013443433 6:110195344-110195366 AGGCATAATAAGAAATAGTCTGG - Intronic
1013491559 6:110651434-110651456 ACACATAATAAAAAATAGGCCGG + Intronic
1014093543 6:117433516-117433538 ATGCATAAAAATGTGTAAGCTGG - Intronic
1015673299 6:135716580-135716602 ATACATCATAATAAGTAAACTGG - Intergenic
1017060959 6:150484653-150484675 ATGCAGAATAACAGGTAGGTAGG - Intergenic
1019951398 7:4375985-4376007 ATGCATTATAATAAGCAGTGAGG - Intergenic
1021739148 7:23667884-23667906 AAGCATTATACTAAGTAGTCAGG - Intergenic
1022002129 7:26236032-26236054 AGAAAAAATAATAAGTAGGCCGG + Intergenic
1026952760 7:74358511-74358533 TTGCAGTATAATAAGTAGCCGGG - Intronic
1028601178 7:92602021-92602043 AAGAATAATAATAATTAGCCAGG + Intergenic
1029004064 7:97188756-97188778 AGGCATTATAAAAAGTAGGCTGG + Intergenic
1029022972 7:97384963-97384985 AAGAATATTAATATGTAGGCCGG - Intergenic
1029616775 7:101664329-101664351 ATGCAAATTAATGAGTAGCCTGG - Intergenic
1030564570 7:111137273-111137295 ATTTATAATAATAAGCATGCTGG + Intronic
1032933529 7:136702016-136702038 ATCCATATTAATGAGTAGCCTGG + Intergenic
1035415086 7:158676695-158676717 ATGCATAATAAAAAAGAGACTGG - Intronic
1037156804 8:15710622-15710644 CTGCATTTTAATAAGTAGCCTGG - Intronic
1038032827 8:23659665-23659687 ATGCCTTAAAAAAAGTAGGCAGG + Intergenic
1038806337 8:30795850-30795872 AGGCATAATTATAACTATGCAGG - Intronic
1039340303 8:36641676-36641698 ATGTATAAAAACAACTAGGCTGG + Intergenic
1039781227 8:40788286-40788308 AAGCTTAAGAATAAATAGGCTGG + Intronic
1041750684 8:61257718-61257740 ATTTAAAAAAATAAGTAGGCTGG + Intronic
1044260877 8:90119063-90119085 TTGCTTAATAAAAACTAGGCAGG + Intergenic
1044435411 8:92156541-92156563 ATGCAAAATAACAATTAGACAGG + Intergenic
1044584134 8:93853638-93853660 ATGAATAAAAATAAGTAAGTGGG + Intergenic
1044884346 8:96760608-96760630 ATGCATTATAATCAGTACTCTGG + Intronic
1045398717 8:101788621-101788643 ATGCATAAAATAAAGTATGCAGG - Intronic
1046655830 8:116893225-116893247 GTGCGGAATAATAAGTAGGCTGG + Intergenic
1049036397 8:140079628-140079650 GTGCATAATAATAAAAAGGCAGG + Intronic
1051302146 9:15663455-15663477 AAGAATAAAAATAAGCAGGCAGG - Intronic
1051498595 9:17752656-17752678 ATAAATAATAAAAATTAGGCAGG - Intronic
1052130232 9:24835861-24835883 GTGCATAATAATGAATAGGAAGG - Intergenic
1053408321 9:37897349-37897371 ATGAATAATAATAATCAGGCAGG - Intronic
1053632058 9:39953047-39953069 ATGCATAAAAATGAATAGACTGG + Intergenic
1053773707 9:41510484-41510506 ATGCATAAAAATGAATAGACTGG - Intergenic
1054211830 9:62297651-62297673 ATGCATAAAAATGAATAGACTGG - Intergenic
1054313154 9:63551182-63551204 ATGCATAAAAATGAATAGACTGG + Intergenic
1056895356 9:90542334-90542356 ATTAATAATATTAAGTAGGTGGG + Intergenic
1057236857 9:93367799-93367821 ATGCATATAAGTAAATAGGCTGG - Intergenic
1058336760 9:103838785-103838807 AAACATAAAAATAAGTAGCCAGG - Intergenic
1058718640 9:107743596-107743618 ACAAATAATAATAAATAGGCTGG - Intergenic
1059687023 9:116647578-116647600 ATGCATAGCAATAGATAGGCTGG - Intronic
1189470730 X:41312016-41312038 GTGAAGAATAATAAATAGGCTGG + Intergenic
1189822827 X:44886785-44886807 ATACAAGATAGTAAGTAGGCCGG - Intronic
1189826926 X:44928642-44928664 ATTGATAATAATAAGGAGACGGG + Intronic
1191135858 X:57064170-57064192 ATGCATAGTACTATGTATGCTGG - Intergenic
1192904328 X:75534274-75534296 ATGCATTATCAAAACTAGGCTGG - Intergenic
1195208045 X:102624237-102624259 ATGCATAATGGTCAGTAGGTAGG + Intergenic
1195634557 X:107099181-107099203 ATCCATAATAATAAAAAGACTGG + Intronic
1196241571 X:113348039-113348061 ATACATAATAAAAAGATGGCAGG - Intergenic
1199761956 X:150911702-150911724 AATAATAATAATAAATAGGCTGG - Intergenic
1199907514 X:152248705-152248727 ATGCATATTTATAATTAGGTAGG + Intronic
1200341143 X:155397049-155397071 ATATATAATATTATGTAGGCTGG - Intergenic
1201145497 Y:11062983-11063005 ATCCACAATAATAAGCAGACGGG + Intergenic
1202023914 Y:20500055-20500077 ATGGATAAAAATAAGTATGGAGG - Intergenic
1202065584 Y:20936098-20936120 ATTAATAATAATAATAAGGCTGG + Intergenic