ID: 904783000

View in Genome Browser
Species Human (GRCh38)
Location 1:32964593-32964615
Sequence GCCGCAGCGGCGGCCGGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 891
Summary {0: 1, 1: 0, 2: 9, 3: 90, 4: 791}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904783000_904783009 13 Left 904783000 1:32964593-32964615 CCGGCGCCGGCCGCCGCTGCGGC 0: 1
1: 0
2: 9
3: 90
4: 791
Right 904783009 1:32964629-32964651 TGCGGCCGCATGTAGCGATGTGG 0: 1
1: 0
2: 0
3: 2
4: 23
904783000_904783008 -5 Left 904783000 1:32964593-32964615 CCGGCGCCGGCCGCCGCTGCGGC 0: 1
1: 0
2: 9
3: 90
4: 791
Right 904783008 1:32964611-32964633 GCGGCACTTAGGGTCGGGTGCGG 0: 1
1: 0
2: 0
3: 4
4: 96
904783000_904783011 20 Left 904783000 1:32964593-32964615 CCGGCGCCGGCCGCCGCTGCGGC 0: 1
1: 0
2: 9
3: 90
4: 791
Right 904783011 1:32964636-32964658 GCATGTAGCGATGTGGAGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 49
904783000_904783007 -10 Left 904783000 1:32964593-32964615 CCGGCGCCGGCCGCCGCTGCGGC 0: 1
1: 0
2: 9
3: 90
4: 791
Right 904783007 1:32964606-32964628 CCGCTGCGGCACTTAGGGTCGGG 0: 1
1: 0
2: 0
3: 2
4: 34
904783000_904783012 28 Left 904783000 1:32964593-32964615 CCGGCGCCGGCCGCCGCTGCGGC 0: 1
1: 0
2: 9
3: 90
4: 791
Right 904783012 1:32964644-32964666 CGATGTGGAGCGCGGCGACTCGG 0: 1
1: 0
2: 0
3: 1
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904783000 Original CRISPR GCCGCAGCGGCGGCCGGCGC CGG (reversed) Exonic
900091748 1:923865-923887 CCCGGCGCGGCGGGCGGCGCGGG - Intergenic
900113779 1:1020196-1020218 GCGGCAGCAGCGGCCGCAGCGGG - Exonic
900171937 1:1273590-1273612 GCCGCCGCTGTGGCCGGCTCCGG + Intronic
900201107 1:1407058-1407080 GGCCAAGGGGCGGCCGGCGCGGG - Intronic
900237455 1:1599559-1599581 GCGGCAGCGGCTGCAGGCACAGG + Exonic
900284089 1:1891008-1891030 GCGGCGGCGGCGGCGGGAGCGGG - Exonic
900513251 1:3070036-3070058 GTCGCCCCGGCGGCCCGCGCAGG - Intronic
900542619 1:3211638-3211660 GCAGCAGTGGGGGCCGGCGCTGG + Intronic
900679781 1:3910484-3910506 CCTGCAACGGCGGCTGGCGCCGG + Intergenic
901628970 1:10639021-10639043 GCGGCGGAGGCGGCGGGCGCGGG - Exonic
902323567 1:15684297-15684319 GCCGCGGCGGCGGCGGCGGCAGG - Intergenic
902659494 1:17891352-17891374 GCAGCAGCGGCGGCGGCAGCAGG - Intergenic
903115521 1:21176259-21176281 GCCGCCGCTGCTGCCGCCGCCGG + Exonic
903324746 1:22563459-22563481 GCGGCGGCGGCGGCGGGCGCGGG + Intergenic
903468450 1:23568408-23568430 GCCGCGGCGGGGCCAGGCGCCGG + Intergenic
903652366 1:24929914-24929936 CCCCCGGGGGCGGCCGGCGCGGG + Intronic
903738201 1:25543668-25543690 GCGGCAGCGGCGGCGGCGGCCGG + Exonic
903738203 1:25543674-25543696 GCGGCGGCGGCGGCCGGAGCGGG + Exonic
903750400 1:25617455-25617477 GCCGCAGCGCGGGAAGGCGCGGG + Exonic
903907688 1:26697433-26697455 GCTGCGGCGGCGGCCGCCTCGGG + Exonic
903925226 1:26826913-26826935 GCGGGGGCGGCGGGCGGCGCGGG - Exonic
903925247 1:26826962-26826984 GCGGCAGCGGCAGCGGGAGCGGG + Exonic
904006065 1:27364003-27364025 GCCACAGCTGCGGCAGGAGCTGG - Exonic
904215381 1:28914725-28914747 GCTGCAGCAGTGGCGGGCGCAGG + Intronic
904618875 1:31763900-31763922 GCAGGAGCGGGGGCCGGCGCTGG + Exonic
904642034 1:31938269-31938291 GCGGCAGCGGCGGCCGGGCACGG - Exonic
904782968 1:32964471-32964493 GCCGCGGCAGGGGCCGGGGCGGG + Exonic
904783000 1:32964593-32964615 GCCGCAGCGGCGGCCGGCGCCGG - Exonic
905137092 1:35808249-35808271 GCGGCGGCGGCGCCCGGCCCGGG - Exonic
905580799 1:39081724-39081746 GCAGCCCCCGCGGCCGGCGCCGG + Intronic
905584340 1:39105326-39105348 GCTGCAGCGGCGGGCGGCGGCGG - Intronic
905639147 1:39576586-39576608 AGCGCTGCGGCGGCGGGCGCGGG + Intronic
905734722 1:40317181-40317203 GCCGTAGCGGCGGCCATGGCTGG + Exonic
906204394 1:43979334-43979356 GCCGCCGCCGCCGCCGCCGCGGG - Intronic
906640573 1:47438424-47438446 GCCGCCGCGGCGCCTGGCCCCGG - Exonic
906960923 1:50419101-50419123 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
907069295 1:51519309-51519331 GCCGCAGGCGAGGCCGGGGCGGG + Exonic
907430053 1:54406369-54406391 GCCGCCGCCGCCGCCGCCGCTGG + Exonic
907486433 1:54781323-54781345 GGCCCAGGGACGGCCGGCGCTGG - Exonic
908132162 1:61083723-61083745 GCCGGAGCGGCGGCCCGGGCCGG + Intronic
908354914 1:63319707-63319729 GGCGAAGCGGCGGCCGGGGAGGG - Intergenic
910237338 1:85048754-85048776 TCCGGAGCTGCCGCCGGCGCCGG + Intronic
912337622 1:108877170-108877192 GGTGCAGCGGCGGCCGCCTCGGG - Exonic
914125465 1:144813794-144813816 GGCGGAGAGGCGGCCGGCGGCGG - Intergenic
914293587 1:146297991-146298013 GTCGGAGCGGCCGCCGGCCCCGG + Intergenic
914428599 1:147600194-147600216 GCCGCCGCCGCTGCCGCCGCCGG + Intronic
914554631 1:148748774-148748796 GTCGGAGCGGCCGCCGGCCCCGG + Intergenic
914730386 1:150364649-150364671 GCGGCGGCGGCGGCGGGAGCGGG - Intronic
915128000 1:153679159-153679181 GCAGCAGCGGCGGCAGCAGCAGG - Exonic
915167860 1:153958534-153958556 GCCGCGGCGGAGGCCGCGGCTGG - Exonic
915495964 1:156282762-156282784 GCCGCAGCCGCCGCCGCCACCGG + Exonic
915747743 1:158177789-158177811 GCCGCAGTGGAGGCTGGAGCTGG - Intergenic
916651711 1:166839730-166839752 GCCGGGGAGGCGGGCGGCGCCGG + Intronic
916694370 1:167221257-167221279 GCGGCAGCGGCGGCCGGCAGAGG - Intronic
917202607 1:172533198-172533220 GCTGCAGCGGCGGCGGTCCCCGG + Exonic
918066486 1:181105276-181105298 GCAGCCGCGGGCGCCGGCGCAGG - Intergenic
919847030 1:201648768-201648790 GCGGCAGCGGCGGACGGCAGAGG + Exonic
919991284 1:202709926-202709948 GGCGCAGAGCCGGCCGGTGCAGG + Intronic
920379945 1:205529436-205529458 GCAGGAGGGGCGGCGGGCGCAGG - Intronic
921217737 1:212951477-212951499 GCGGCAGCGGCGGCGGCGGCGGG - Exonic
921472722 1:215567713-215567735 CCCGCGGCGGCGGCCGGCAGCGG + Exonic
922472848 1:225887541-225887563 GCAGCAGCGGCTGCCGGGGCCGG + Exonic
922480860 1:225939503-225939525 GCAGCAGCGGCTGCCGGGGCCGG + Exonic
922586380 1:226737469-226737491 GCCGCGGCGGCGGGCAGCGCGGG - Exonic
922691272 1:227693407-227693429 GCTGCAGCTGCGGCTGGTGCTGG + Intergenic
923191771 1:231626892-231626914 GCCCCAGCCGCCGCCGGCGGCGG + Exonic
924052315 1:240091892-240091914 GCCGCAGCGACGGCAGCCACGGG + Exonic
924172419 1:241356684-241356706 GCCGCGGCGGCCGCCGGAGCCGG + Intronic
924527327 1:244863952-244863974 GCCGCGGGGGCGGCCGACTCGGG - Exonic
924754787 1:246931493-246931515 GCCGCCGCCGCCGCCGCCGCGGG + Intronic
1064230782 10:13528443-13528465 GCCGCCGGGGCGGCGGGGGCAGG - Intronic
1064442985 10:15370675-15370697 GCCGCAGCGGCGACAGCAGCTGG + Intronic
1064443210 10:15371382-15371404 GACGCAGCGGCGCCGGGCGGGGG - Intergenic
1065023084 10:21516867-21516889 GCGGCGGCGGCGGCCGCCGCGGG - Exonic
1065342971 10:24723664-24723686 GCGGCGGCGGCGGGCAGCGCGGG - Exonic
1065712822 10:28533488-28533510 GCGGCGGCGGCGGCGGGCGGCGG - Exonic
1066464405 10:35640348-35640370 GGCGGCGCGGCGGCGGGCGCGGG - Exonic
1068538612 10:58267839-58267861 GCCGCCGCAGCCGCCGGCCCCGG + Exonic
1069424685 10:68279044-68279066 GCAGCAGCGGCGGCGGGGGAGGG + Intergenic
1070079139 10:73168291-73168313 TCCTCAGCCGCGGCCGGGGCAGG - Exonic
1071086738 10:81874974-81874996 GCAGCAGCAGCAGCGGGCGCGGG + Intergenic
1071527450 10:86366599-86366621 GCCGCAGCCGCCACCGGAGCCGG - Intergenic
1071695356 10:87863795-87863817 GCCGCCGCTGCCGCCGCCGCAGG - Exonic
1072089634 10:92115040-92115062 GCCCCGGCGGCCGCGGGCGCGGG + Intronic
1072408992 10:95183575-95183597 GAGGCGGCGGCGGCCGGAGCCGG + Intergenic
1072700917 10:97640854-97640876 GTGGCGGCGGCGGCCGGCTCGGG + Exonic
1073061336 10:100735544-100735566 GCCGTGGCGGCGGGCGGCTCGGG + Intergenic
1073137375 10:101227438-101227460 GCCGCAGCCGCCGCCACCGCCGG + Exonic
1073325978 10:102644170-102644192 GCCGCCGCTGCCGCCGCCGCCGG + Intergenic
1073446582 10:103584585-103584607 GCCGCAGCGACGGCCGCCGCAGG - Exonic
1074008956 10:109457110-109457132 GCCGCCGCGCAGGCGGGCGCTGG + Intergenic
1075054586 10:119207810-119207832 GCCGCCGCTGCTGCCGGAGCCGG - Exonic
1075334206 10:121597382-121597404 CCCGCAGCCGCCGTCGGCGCTGG - Intronic
1075430394 10:122375115-122375137 CCCTCAGCGGCGCCCGGCGGGGG + Intronic
1075645466 10:124093338-124093360 GCGCCGGCGGCGGCCGGGGCTGG - Intronic
1075748486 10:124744225-124744247 TCCGCGGCGGCGGCGGGTGCGGG - Intronic
1075877915 10:125823167-125823189 GCCGCGGCGGCCACCCGCGCCGG + Exonic
1076638915 10:131901020-131901042 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
1076722087 10:132397163-132397185 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
1076855713 10:133114831-133114853 GGCGCAGGGGCGGGCGGAGCAGG - Intronic
1076998614 11:311203-311225 CCCCTGGCGGCGGCCGGCGCAGG + Intronic
1077000129 11:318556-318578 CCCCTGGCGGCGGCCGGCGCAGG - Intergenic
1077213337 11:1383433-1383455 GCAGCAGCGGAGGCCGCGGCCGG + Intergenic
1077247502 11:1546753-1546775 GCCCCAGCCTCGGCGGGCGCGGG + Intergenic
1077361176 11:2140732-2140754 GCCGCCGGGGAGGCCGGCGTGGG - Intronic
1077495485 11:2884852-2884874 GCCGGGGCGGGGGCCGGGGCCGG + Exonic
1077495523 11:2884930-2884952 GCCGGAGCCGGGGCCGGGGCCGG + Exonic
1077495549 11:2885002-2885024 GCCGGAGCCGGGGCCGGGGCTGG + Exonic
1078771796 11:14358714-14358736 GCCGGAGCGGCGGCGGGCGGGGG - Intronic
1078801117 11:14644503-14644525 GCCGCAGCTCCGGCCCGGGCCGG - Exonic
1079076724 11:17389146-17389168 GCGGCGGCGGCGGGCGGGGCCGG - Intronic
1079450781 11:20598298-20598320 GCCGCGGCGGCCGCGGCCGCAGG - Intergenic
1080012422 11:27472317-27472339 GCCGCGGGAGAGGCCGGCGCGGG - Exonic
1081700146 11:45147365-45147387 CCCGCAGCAGCCCCCGGCGCGGG - Exonic
1081870783 11:46381690-46381712 GGGGCCGCGGCGGCCGGAGCGGG + Intronic
1082076616 11:47980466-47980488 GCCGCCGGGCCGGCCGGGGCGGG + Intergenic
1082283655 11:50298206-50298228 GCCGCGGCTGCAGCTGGCGCTGG + Intergenic
1083178643 11:60970506-60970528 GCGGCAGCAGGTGCCGGCGCTGG + Intergenic
1083329617 11:61891472-61891494 GCCGGAGCAGCGGGCGGCGGCGG - Exonic
1083811351 11:65108524-65108546 GGTGGAGCGGCGGCTGGCGCAGG + Exonic
1083945044 11:65919000-65919022 GCGGCGGCGGCGGCCGTGGCGGG - Exonic
1083958850 11:66002740-66002762 GCCGCAGCGGCGCGCGGTGGGGG + Intronic
1084021323 11:66420004-66420026 GCCGCAGCCGCGGCAGCCGCCGG + Intergenic
1084180608 11:67443705-67443727 GCCTCTGCGGCGGCCGCCGTCGG - Intronic
1084204410 11:67583677-67583699 GGTGCAGCGGCCGCCGGGGCTGG + Exonic
1084284166 11:68120946-68120968 GCGGCTGCGGCGGCGGGGGCTGG + Exonic
1084522930 11:69675433-69675455 GCTGCAGCGGTGGGCGGGGCCGG + Intergenic
1085332823 11:75667735-75667757 GCCTCAGCGGCGGCCTGCACTGG + Exonic
1085346025 11:75768707-75768729 GCCGACGCGGCGGGCGGGGCGGG - Intronic
1088764338 11:112961877-112961899 GCCGGAGGGGCGCCGGGCGCTGG - Intronic
1089432655 11:118436565-118436587 GCGGCGGCGGCGGGGGGCGCCGG + Exonic
1089499287 11:118923119-118923141 GCAGCAGCAGCTGCCGGGGCAGG - Intronic
1089543668 11:119206289-119206311 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
1090699176 11:129279234-129279256 GCGGCGGCGGCGGCGGGCGGAGG - Intronic
1091558604 12:1594215-1594237 GCGGCGGCGGCGGCCGGAGCCGG - Intronic
1093685127 12:22046363-22046385 GCAGCTTCGGCGGCCGGCCCCGG - Exonic
1094041036 12:26122316-26122338 GCCGCGGCTGCCGCCGGGGCGGG + Exonic
1094041122 12:26122642-26122664 GCCGCCGCTGCCGCCGCCGCGGG + Exonic
1094041716 12:26126125-26126147 GCAGCCGCGGCGCTCGGCGCCGG + Intronic
1094107998 12:26833385-26833407 GCCGCCGCACCGGCCCGCGCGGG + Intergenic
1095945164 12:47749560-47749582 GCGGCAGGGGCGGCAGGGGCGGG - Intronic
1096255070 12:50057794-50057816 GCCGCGGCGGCCGCGGGCTCCGG + Exonic
1096298057 12:50400859-50400881 GCCGCAGCGGCTGACGGCAGGGG + Intronic
1096309170 12:50505162-50505184 GCCGCCACCGCGGCCGGCGACGG - Exonic
1096466186 12:51848683-51848705 GCGGCTGCTGCGGCCGCCGCGGG + Intergenic
1096848165 12:54419120-54419142 GCAGCAGCGGGGGTCGGCGCCGG + Exonic
1096983739 12:55743398-55743420 GCCGCCGCCGCCGCCGCCGCGGG - Exonic
1097046257 12:56189542-56189564 GCCGCGGCGGCGGGAGGCGGCGG - Exonic
1097648138 12:62260606-62260628 GCTGCCCCGGCGGCCGCCGCCGG - Intronic
1098029055 12:66235420-66235442 CGCGCGGCGGCGGCCGGCGGGGG + Intronic
1098105965 12:67069319-67069341 GCGGCGGCGGCGGCCGGGCCGGG + Intergenic
1100309136 12:93378144-93378166 GTCGGAGCGGCCGCCGGCCCCGG + Exonic
1100391309 12:94148357-94148379 GCGGCCGCGGCGGCCGCGGCGGG + Intergenic
1102136863 12:110582939-110582961 GCCGCCGCCGCCGCCGGCCCTGG + Exonic
1103120087 12:118372866-118372888 GCAGCAGCGGCGGCGGCCGCGGG - Exonic
1103363942 12:120369136-120369158 GCGGCGGCGGCGCTCGGCGCGGG + Exonic
1103509861 12:121467010-121467032 GCCGGCGGGGCGGCCGGGGCCGG - Intronic
1103563404 12:121804105-121804127 GCCGCCGCGGCTGCCGGGCCCGG - Intergenic
1103764724 12:123271864-123271886 GCCGGCGGGGCGGCCGGGGCCGG + Exonic
1103779479 12:123389340-123389362 GCCGTCGCGGCGCCCGGCCCGGG + Intronic
1104049561 12:125186487-125186509 GCCGCGGCGGCGGCGGCGGCGGG + Intergenic
1104624313 12:130339079-130339101 AGCGCAGCGGCGGCGGACGCGGG - Intronic
1104857235 12:131907979-131908001 GCCACAGTGCCGGCGGGCGCGGG + Intronic
1105472073 13:20703742-20703764 GCGGCGGCGGCGGCGGGGGCCGG + Intronic
1105475071 13:20721788-20721810 GACGGAACGGCCGCCGGCGCAGG - Exonic
1106241997 13:27920258-27920280 GCGGCGGCGGCGGCGGGGGCTGG - Exonic
1108615694 13:52129472-52129494 GCCACAGCGGCGGCCTGCCAAGG + Intergenic
1110119758 13:71866530-71866552 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1110705972 13:78602253-78602275 GCGGGCGCGGCGGCCGGCGGCGG - Exonic
1111951278 13:94711391-94711413 GCAGCGGCGGCCGCCGCCGCCGG - Exonic
1111951317 13:94711550-94711572 GCCGCCGCCGCCGCCGCCGCGGG - Exonic
1112271902 13:97976480-97976502 CCCGCCGCGGCCGCCGGCGCCGG - Intronic
1112505097 13:99970633-99970655 GCCGCAGCAGCGGCCGGGCCCGG - Exonic
1112507133 13:99981895-99981917 GCGGCGGAGGCGGCGGGCGCAGG + Exonic
1112507813 13:99985446-99985468 GCCGCCGCTGCCGCCGCCGCTGG - Exonic
1113377898 13:109782133-109782155 GCAGCACCGGCGGCGGGTGCGGG - Exonic
1113614697 13:111671863-111671885 GGTGCAGGGGCGGCCGGCTCGGG - Intronic
1113620166 13:111756777-111756799 GGTGCAGGGGCGGCCGGCTCGGG - Intergenic
1113914802 13:113863866-113863888 GCAGCTGCGGCGCGCGGCGCAGG + Exonic
1113967346 13:114161488-114161510 GCCACAGCGGCGGGGGGCGGGGG + Intergenic
1114037928 14:18646560-18646582 ACCGCTGCGGCCGCCGCCGCTGG + Intergenic
1114120693 14:19668471-19668493 ACCGCTGCGGCCGCCGCCGCTGG - Intergenic
1114270684 14:21098349-21098371 GCGGCGGCGGCGGCGGGCGGCGG + Exonic
1114736727 14:25050028-25050050 GCGGCAGCAGGAGCCGGCGCGGG - Exonic
1115320741 14:32077122-32077144 CCCGGCGCGGCGGCGGGCGCTGG + Intronic
1117119599 14:52553163-52553185 GCGGCAGCGGCCGCCGGACCCGG - Exonic
1117315154 14:54566184-54566206 GCCGTCGGGGCGGGCGGCGCGGG - Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118186455 14:63542846-63542868 GCCGCAGCGGGGGCGGGCGGCGG + Exonic
1118607703 14:67515407-67515429 GCCGCCGCCGCCGCCGCCGCCGG - Intronic
1118849483 14:69573096-69573118 GCGGCGGCGGCGGCGGCCGCGGG + Exonic
1119145527 14:72310267-72310289 GCAGCAGCGGCGTCAGCCGCTGG + Intronic
1119438490 14:74612687-74612709 TCCGCAGGGCCGGCCGGAGCGGG + Intergenic
1119759548 14:77141161-77141183 GCCGCAGCCCCCGGCGGCGCAGG - Intronic
1119821038 14:77616452-77616474 GCCGCAGCCGCAGCCGCCGCCGG - Exonic
1121417478 14:93788952-93788974 GAGGCAGCGGCGGGAGGCGCCGG + Intergenic
1121767799 14:96502535-96502557 GCGGCAGCGGCGGCGGTTGCGGG + Exonic
1122066151 14:99175605-99175627 GCGGCAGCGGCGGCGTGCTCAGG + Exonic
1122143369 14:99675226-99675248 GCCGGAGGGGCGGCGGGCGGCGG + Exonic
1122162300 14:99793309-99793331 GCGGCGGCGGCGGCGGGCCCGGG + Intronic
1122183498 14:99971991-99972013 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1122221175 14:100239812-100239834 GCCGGCGCGGCGGGCGGCGGCGG + Exonic
1122221239 14:100240070-100240092 GCGGCGGCGGCGGCGGGCGGCGG + Intronic
1122445018 14:101761786-101761808 GCGGCGGCGGCGGCGGCCGCGGG + Exonic
1122486758 14:102087136-102087158 GCCGCGGCGGCGGCTGGGGAGGG - Intronic
1122542839 14:102507560-102507582 GCAGCAGCGGAAGCCGGCACTGG + Exonic
1122582117 14:102777544-102777566 GCGGCAGCCGCGGCGGCCGCCGG + Exonic
1122918211 14:104868479-104868501 GCAGCAGCGGCGCCCGCCACCGG + Exonic
1122976946 14:105174629-105174651 GGCGCAGCCGCGGCCGCCGCCGG - Intronic
1123024956 14:105420108-105420130 GCGGCAGCGGCGGCGGGTGGGGG - Intronic
1123053760 14:105559885-105559907 GCCTCAGCGGCTGCCGCAGCGGG + Intergenic
1123078343 14:105680302-105680324 GCCTCAGCGGCTGCCGCAGCGGG + Intergenic
1123684354 15:22786690-22786712 GCGGCGGCGGCGGCCGGGGAGGG + Exonic
1123739982 15:23226566-23226588 ACCGCAGCGGTGGGCGGAGCCGG + Intergenic
1124291206 15:28455534-28455556 ACCGCAGCGGTGGGCGGAGCCGG + Intergenic
1125200738 15:37099013-37099035 GCCGCCGCCGGGGCCGCCGCTGG - Intronic
1125485603 15:40108808-40108830 GCGGCGGCGGCGGCGGGCACAGG + Exonic
1125674247 15:41494060-41494082 GTCGCTGCGGCCGCCGCCGCGGG + Exonic
1126649633 15:50908250-50908272 GCCGGAGCCGCGCGCGGCGCCGG + Intergenic
1126767006 15:52019444-52019466 GCCGCCGCCGCCGCCGCCGCCGG - Intronic
1127165774 15:56243812-56243834 GCCGCGGCGGCGGCGGGGCCGGG - Intergenic
1128067861 15:64775608-64775630 GCGGCAGCGGCGGCGGGGGGCGG + Intergenic
1128149736 15:65355487-65355509 GCGGCAGGGGCGGCGGGCGAGGG + Intronic
1128161055 15:65422999-65423021 GCCCGAGCTGGGGCCGGCGCGGG + Exonic
1128558842 15:68651218-68651240 GCGGCAGGGGAAGCCGGCGCTGG - Intronic
1129592754 15:76931887-76931909 TGCGCCGCCGCGGCCGGCGCCGG + Exonic
1129676055 15:77632856-77632878 GCCCGAGCGGGAGCCGGCGCGGG - Intronic
1130115483 15:81001651-81001673 CCCGCGACGGCGGCCGGGGCTGG - Exonic
1130517146 15:84634093-84634115 GGCGCTGCAGCGGGCGGCGCGGG - Intergenic
1130531257 15:84748886-84748908 GTCGCAGCGGCGGAAGGGGCCGG - Intronic
1130564425 15:84981696-84981718 GCGGCGGCGGCGGCGGGAGCGGG + Intronic
1130908599 15:88256345-88256367 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1131092454 15:89632927-89632949 GCTACAGCAGCGGCGGGCGCTGG - Exonic
1131263578 15:90902823-90902845 GCGGCAGCGGCGCGCGGAGCAGG + Intronic
1131431747 15:92393908-92393930 GCCGCTGCCGCTGCCGCCGCCGG + Exonic
1131466053 15:92655614-92655636 GCAGCAGCAGCGGCAGGAGCGGG + Exonic
1131694098 15:94856489-94856511 GCAGCAGCGGCGGCGGGAGAAGG + Intergenic
1132589732 16:721421-721443 GCCGCTGCGGCTGCAGGTGCGGG + Exonic
1132641484 16:980494-980516 GCTGCAGCGGCCACCGGCCCGGG + Intronic
1132805520 16:1773419-1773441 GCGGCTGCTGCGGCCGGAGCAGG + Exonic
1132837108 16:1959663-1959685 GCTGCACCGGCGTGCGGCGCGGG - Exonic
1132934937 16:2475343-2475365 GCTGCAGCGCCGGGCGGTGCCGG - Intronic
1133079287 16:3305687-3305709 GCTGGAGCGGCGGCGGCCGCAGG + Intronic
1133156448 16:3880131-3880153 GCGGCGGCGGCGGCCGGGGGCGG - Exonic
1133315982 16:4884364-4884386 GCAGCAGCGGCTGGCAGCGCTGG - Exonic
1133784411 16:8963567-8963589 GCCGCCGCCGCCGCCGCCGCGGG + Intronic
1133933719 16:10252385-10252407 GCCGCGGCGGCAGCCCGGGCTGG - Intergenic
1134492208 16:14703602-14703624 GAGGCCGCGGCGGCCGGAGCAGG - Intergenic
1134497589 16:14742724-14742746 GAGGCCGCGGCGGCCGGAGCAGG - Intronic
1134849871 16:17470899-17470921 GCGGCGGCGGCGGCCCGAGCGGG - Intergenic
1135002652 16:18790076-18790098 GCCGCAGCGCGGGCGGGAGCCGG - Intronic
1136153018 16:28364633-28364655 GAGGCGGCGGCGGCCGGAGCAGG + Intergenic
1136210065 16:28750640-28750662 GAGGCGGCGGCGGCCGGAGCAGG - Intergenic
1136226502 16:28863897-28863919 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1136242198 16:28951335-28951357 GCGGCGGCGGCGGCTGGTGCTGG + Exonic
1136414739 16:30096221-30096243 GCCGCAGCGGCGGCAGCAGCTGG - Intronic
1136417635 16:30113391-30113413 GCAGCAGATGAGGCCGGCGCAGG + Exonic
1136462038 16:30417570-30417592 GCCGGGTCGGCGGACGGCGCGGG - Exonic
1136641549 16:31569424-31569446 GCCGCGGCGGCCGCCACCGCAGG + Intergenic
1136683661 16:31981977-31981999 GGGGCTGCGGCGGCCGGCGCAGG + Intergenic
1137426682 16:48385791-48385813 GCCGCGGCGGCGGCCAGCCTGGG - Intronic
1138178736 16:54928879-54928901 GCGGCTGCGGCGGGCGGAGCCGG + Intergenic
1138179321 16:54931409-54931431 GCGGCGGCGGCGGCGGCCGCGGG - Exonic
1138247622 16:55479275-55479297 GCCGCCGCCGCCGCCGCCGCAGG - Exonic
1138247627 16:55479284-55479306 GCGGCGGCGGCGGCGGGGGCTGG + Exonic
1139451170 16:67029128-67029150 GCGGCGGCGGCGGCCGGGGGCGG + Intronic
1139469450 16:67170488-67170510 GCAGCAGCTGCGGCGGGGGCGGG - Intronic
1140223212 16:73058542-73058564 GCCGCTGCAGCCGCCGCCGCCGG - Intronic
1140223238 16:73058648-73058670 GCAGCAGCGGCGGCTGGCGGGGG + Intronic
1141054613 16:80804012-80804034 GCCGCCGCCGCCGCCGCCGCGGG + Intronic
1141430593 16:83968708-83968730 GCCGCAGCAGGGCCGGGCGCTGG + Exonic
1141608648 16:85169448-85169470 GCGGCGGCGGCGGCCTGGGCGGG + Intergenic
1141704533 16:85657461-85657483 GCGGCAGCGGCGGCTGCGGCAGG + Exonic
1141959020 16:87392351-87392373 GCCGCAGCAGCCGCCGCCCCCGG + Exonic
1142374120 16:89697993-89698015 GCTGCAGCAGCGGCTGGCCCAGG - Exonic
1142474535 17:181264-181286 GGGGCTGCGGCGGCCGGCACCGG + Exonic
1142586943 17:979747-979769 GCGGCGTCGGCGGCAGGCGCTGG + Exonic
1142763717 17:2055041-2055063 GCAGCAGCGCCCGCCGGCCCGGG + Intronic
1142811793 17:2399013-2399035 GCCGCCGCGGCGGGCGGGGGTGG - Intronic
1142811795 17:2399016-2399038 GCCGCCGCCGCGGCGGGCGGGGG - Intronic
1143202676 17:5123123-5123145 GCGGCGGCAGCGGCCGGCGCTGG + Intronic
1143443919 17:6996225-6996247 GCTGCAGCTGCGGCCCGCGCGGG + Exonic
1143510801 17:7394221-7394243 GAGGCAGCTGCGCCCGGCGCCGG + Exonic
1144339674 17:14301369-14301391 GCAGCAGCAGCGGCGGCCGCGGG + Exonic
1144547998 17:16215478-16215500 GCCGCGGCGGCGGCGGCGGCTGG - Exonic
1144672596 17:17141385-17141407 CCAGCAGCGGAGGCAGGCGCTGG - Intronic
1145307523 17:21683607-21683629 GCTGCAGCGGCGGCGGCGGCTGG + Intergenic
1145307754 17:21684772-21684794 GCTGCAGCGGCGGCGGCGGCTGG + Intergenic
1145379007 17:22376857-22376879 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145379485 17:22379227-22379249 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145379964 17:22381597-22381619 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145380444 17:22383969-22383991 GCTGCAGCCGCGGCTGCCGCTGG - Intergenic
1145380922 17:22386319-22386341 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145381402 17:22388694-22388716 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145382135 17:22392468-22392490 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145382610 17:22394833-22394855 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145382890 17:22396196-22396218 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145383463 17:22399019-22399041 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145383977 17:22401487-22401509 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145384415 17:22403689-22403711 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145384734 17:22405151-22405173 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145747771 17:27332835-27332857 GAAGCAGACGCGGCCGGCGCAGG + Intergenic
1145828243 17:27893334-27893356 GCCGCGGCGGCGTCCGGGGCTGG - Exonic
1146214896 17:30971225-30971247 GGCCCAGCGGCGGGCGTCGCGGG - Exonic
1146398660 17:32487297-32487319 GCAGCGGCGGCGGCGGGCGGGGG + Intronic
1147144577 17:38477672-38477694 GCCGCAGCCCCCGCCGCCGCCGG - Exonic
1147144580 17:38477684-38477706 GGGGCTGCGGCGGCCGGCGCAGG + Exonic
1147161773 17:38572780-38572802 GCAGCCGCGGCCGCCGCCGCCGG + Intronic
1147162925 17:38578455-38578477 GCCGCAGCCGCAGCCGCAGCCGG + Intronic
1147179103 17:38673831-38673853 GCCTCGGGGGCGGCCGGCGGGGG + Exonic
1147307401 17:39573630-39573652 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
1147486357 17:40818873-40818895 GCCGGAGCTGCTGCCGCCGCCGG + Exonic
1147486410 17:40819065-40819087 GCCGCCGCCGTGGCCGCCGCCGG + Exonic
1147571160 17:41571936-41571958 GCCGCAGCGGCGGGGGTGGCGGG - Exonic
1147996760 17:44363811-44363833 GCCGCAGCGGGAGCGGGAGCCGG - Exonic
1148178082 17:45584884-45584906 GCGGCAGCGGCGGCGGGGCCGGG + Intergenic
1148262218 17:46193486-46193508 GCCGCAGCCGCAGCCGGCGGAGG - Intronic
1148603054 17:48908595-48908617 GCGGCAGCGGCGGCGGGTTCGGG + Exonic
1148698624 17:49575651-49575673 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
1148714719 17:49707872-49707894 GCCGCCGCTGCTGCCGGTGCCGG - Exonic
1148786840 17:50149739-50149761 GCGGCGGCGGCGGCGGGGGCTGG + Exonic
1149296275 17:55265033-55265055 GGAGCAGCGGCCGCCGGCGCGGG + Exonic
1149430614 17:56593723-56593745 GCCGCCGCCGCCGCCGCCGCTGG + Exonic
1149461856 17:56834801-56834823 AGCGGAGAGGCGGCCGGCGCCGG + Exonic
1149849324 17:60026021-60026043 GGGGCGGCGGCGGCCGGCGCTGG - Intergenic
1149860844 17:60120503-60120525 GGGGCGGCGGCGGCCGGCGCTGG + Intergenic
1149994711 17:61400375-61400397 GCGGCAGCAGCGGCCGAGGCGGG + Exonic
1150326684 17:64263321-64263343 GCGGCGGCGGCCGCGGGCGCGGG - Intergenic
1150561920 17:66302324-66302346 GCGGCGGCGGCGGCCGGGGGAGG - Intergenic
1150840379 17:68601010-68601032 CCCGCGGTGGCAGCCGGCGCCGG - Exonic
1151674120 17:75589185-75589207 GCCGCCGCCGCAGCCAGCGCAGG - Intergenic
1151747844 17:76021411-76021433 GCGGCAGGGGCGGCAGGGGCGGG - Intronic
1151755785 17:76074658-76074680 CCAGCAGCGGCCGGCGGCGCTGG - Intronic
1151780196 17:76240411-76240433 GCCGCCGCGGTGCCCGGCGGAGG - Intergenic
1151780372 17:76240976-76240998 CCCTCAGCGTCGGCCGGCGGAGG + Intergenic
1152049187 17:77959097-77959119 GCCGCCGCCGCCGCCCGCGCCGG + Intergenic
1152357328 17:79813503-79813525 GCGGCGGGGGCGGCGGGCGCGGG + Intergenic
1152363677 17:79843642-79843664 GCGGCGGCGGCGGCGGGCGGTGG - Intergenic
1152581146 17:81166116-81166138 GCGGCTGCGGCGGGGGGCGCGGG - Intergenic
1152587288 17:81194706-81194728 GCCGCAGCGGAGGCCGTGACGGG + Intronic
1152721896 17:81927499-81927521 GCGGCTGCGGCGGCGGGCCCGGG - Intronic
1152748518 17:82051999-82052021 GCCCCAGTGGCGGGGGGCGCGGG - Exonic
1152825004 17:82458974-82458996 GGCGTGGAGGCGGCCGGCGCGGG + Intronic
1152924155 17:83079884-83079906 GCGGGAGCGGCGGCGGGGGCGGG - Exonic
1153448262 18:5197261-5197283 GCCACAGCGGCGGCGGGAGGAGG + Intronic
1153794399 18:8609486-8609508 GCCGCTGCCGCCGCCGCCGCCGG - Exonic
1154151386 18:11908881-11908903 GCCACCGCGGCGGCCGGGGGCGG + Exonic
1154303993 18:13217793-13217815 GCCGCGGCGGCGCGCGGAGCGGG - Intronic
1154940789 18:21111368-21111390 GCCCGAGCGGCGGCCGCAGCTGG - Exonic
1155392616 18:25351822-25351844 GCGGCGCCGGCGGCTGGCGCTGG + Intronic
1155392635 18:25351908-25351930 GCGGCAGCGGCGGCGAGAGCAGG + Intronic
1156036155 18:32770288-32770310 GCAGCAGCAGCCGCCGCCGCAGG - Exonic
1156171705 18:34493866-34493888 GCGCTAGCCGCGGCCGGCGCCGG - Intronic
1157867237 18:51197342-51197364 GCGGCGGCGGCGGCCGGGTCAGG + Intronic
1158653578 18:59308694-59308716 GGCGCAGCGGTCGCCAGCGCGGG - Intronic
1160204629 18:76822688-76822710 GCCCCGCCGGCGGCCGGTGCGGG + Intronic
1160703564 19:518927-518949 GCCTGAGCGCCGGCGGGCGCAGG + Exonic
1160725378 19:615949-615971 GCCGCCGCCGCCGCCGCCGCAGG + Exonic
1160763560 19:797554-797576 GCCGGCGCGGCGGCGGGGGCAGG - Intronic
1160771200 19:831952-831974 GCCGGAGCGGGGGCAGGGGCGGG - Exonic
1160864568 19:1251092-1251114 GCGGCGGCGGCCGCCTGCGCCGG + Intronic
1161215829 19:3094625-3094647 GCGGCCGCGTCGGCCGGGGCCGG + Exonic
1161241154 19:3224696-3224718 GCGGCGGCGGCGGCGGGCGGCGG - Exonic
1161266382 19:3366598-3366620 GGCGCAGGGCCGGCCGGAGCGGG - Exonic
1161397980 19:4054691-4054713 GCAGCGGCGGCGGCGGCCGCGGG + Exonic
1161495015 19:4581744-4581766 GTCGCAGCGGCGGCCGCGGCGGG - Intergenic
1161505085 19:4639514-4639536 GCCGGAGCCGGGGCCGGGGCCGG - Intronic
1161604373 19:5206583-5206605 GTCGCTGGGGCGGCCGGGGCCGG + Exonic
1161628592 19:5340233-5340255 GCCCCGGCGGCGCCCGGCCCGGG - Intronic
1161960493 19:7520476-7520498 GCAGCAGCGGCCGCCGGCCTGGG + Exonic
1162235912 19:9309615-9309637 GCCGCGGCGGCGGGAGGCCCCGG + Intronic
1162312413 19:9914743-9914765 GGCCCAGCGGCTGCCGCCGCCGG - Intronic
1162412504 19:10514981-10515003 GGGGCTGCTGCGGCCGGCGCCGG - Exonic
1162470926 19:10871661-10871683 GGCGCAGCGGCGGCGGCGGCGGG + Exonic
1162778630 19:12995510-12995532 GCGGCGGCGGCGGCGGGCGAGGG + Intergenic
1162802331 19:13118395-13118417 TCCGCAGCGGCGGCTGGGGCCGG - Exonic
1162914377 19:13866070-13866092 GCCGGAGGGGCGGCCCGCGCAGG - Intronic
1162954324 19:14090033-14090055 GCCGCAGCCACAGCCGCCGCCGG - Exonic
1162959469 19:14117549-14117571 GCGGCGGCGGCGGCCGGGGCCGG + Exonic
1163012197 19:14433312-14433334 GCCCCAGCGGCCGCCGGGCCTGG - Intronic
1163287113 19:16355758-16355780 GCGGCTGCGGCGGCAGGAGCAGG - Exonic
1163606982 19:18280985-18281007 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
1163607137 19:18281566-18281588 GCCGCGGCCGGGGCGGGCGCAGG - Exonic
1163607138 19:18281572-18281594 GCTGCGGCCGCGGCCGGGGCGGG - Exonic
1163636185 19:18438112-18438134 GCAGCGGCGGCGGACAGCGCGGG + Exonic
1163804151 19:19386014-19386036 GCCGCCACAGCGGCCGCCGCGGG + Exonic
1163807251 19:19406449-19406471 GCCGCCGCCGCCGCCGCCGCGGG - Intronic
1164803358 19:31096284-31096306 GCCGGAGCTCCGGCCGGGGCTGG + Intergenic
1165157223 19:33796044-33796066 GCCGCCGCGGCGCCCGGGGCTGG - Intronic
1165242806 19:34481556-34481578 GACGCAGGGGCGGGCGGCGGAGG - Intergenic
1165448287 19:35868678-35868700 GCGGCAGCGGCGGCTGGCCCGGG - Exonic
1165601638 19:37059243-37059265 GCCGCGGCGGCGGCTGGATCCGG - Intronic
1165745978 19:38229613-38229635 GCGGCAGCGGCGCCCCGGGCCGG - Intronic
1165850862 19:38849707-38849729 GCCGGGGCGGCGGGCGGCGGCGG - Exonic
1166041583 19:40205973-40205995 GCAGCTGCGGCGGCGGGAGCAGG + Exonic
1166195574 19:41203550-41203572 GGCGCAGCGGCTGCTGGCGCTGG + Exonic
1166361250 19:42253866-42253888 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1166389558 19:42401576-42401598 GCTGCTGCGGCGACCGCCGCAGG - Exonic
1166759517 19:45215887-45215909 GCAGCAGCGGCGGCAGGAGAAGG + Intronic
1166852847 19:45768687-45768709 GCGGCGGCGGCGGCCGGGGCCGG - Exonic
1166975122 19:46601370-46601392 GCTGCAGCTGCTGCCGCCGCCGG + Exonic
1167001038 19:46746034-46746056 GCCGCCGGGACGGCCGGCGGGGG - Exonic
1167158794 19:47754855-47754877 GCAGCAGCGGCGGCGGGAGAAGG + Exonic
1167209343 19:48123273-48123295 CCCGGAGCAGCTGCCGGCGCCGG + Exonic
1167258102 19:48443017-48443039 GCCGCGGCGGCGGGGGGCGCGGG - Exonic
1167466142 19:49651902-49651924 CCAGCAGCGGCGGCCGGGGCGGG - Exonic
1167466217 19:49652164-49652186 GCCGCCGCGGGGGCAGCCGCAGG + Exonic
1167643698 19:50695071-50695093 GCGGCGGGGGCGGCCGGCACCGG - Intronic
1167781437 19:51601513-51601535 CCCACAGCGGGGGCAGGCGCCGG - Intergenic
1168256137 19:55166378-55166400 GCCGAAGCCGCTGCCGGAGCCGG + Exonic
1168335937 19:55597813-55597835 GCGGCAGCGGCGGGCGGTGCTGG + Exonic
1168721770 19:58558394-58558416 GCCGCCGCTGCCGCCGCCGCGGG + Exonic
1202693078 1_KI270712v1_random:104994-105016 GGCGGAGAGGCGGCCGGCGGCGG + Intergenic
1202693102 1_KI270712v1_random:105081-105103 GGCGGAGAGGCGGCCGGCGGCGG + Intergenic
1202693114 1_KI270712v1_random:105125-105147 GGCGGAGAGGCGGCCGGCGGCGG + Intergenic
1202693126 1_KI270712v1_random:105169-105191 GGCGGAGAGGCGGCCGGCGGCGG + Intergenic
1202693138 1_KI270712v1_random:105213-105235 GGCGGAGAGGCGGCCGGCGGCGG + Intergenic
1202693150 1_KI270712v1_random:105257-105279 GGCGGAGAGGCGGCCGGCGGCGG + Intergenic
1202693162 1_KI270712v1_random:105301-105323 GGCGGAGAGGCGGCCGGCGGCGG + Intergenic
1202693174 1_KI270712v1_random:105345-105367 GGCGGAGAGGCGGCCGGCGGCGG + Intergenic
1202693186 1_KI270712v1_random:105389-105411 GGCGGAGAGGCGGCCGGCGGCGG + Intergenic
1202693198 1_KI270712v1_random:105433-105455 GGCGGAGAGGCGGCCGGCGGCGG + Intergenic
1202693209 1_KI270712v1_random:105477-105499 GGCGCAGAGGCGGCCGGCGGCGG + Intergenic
1202693221 1_KI270712v1_random:105521-105543 GGCGGAGAGGCGGCCGGCGGCGG + Intergenic
1202693231 1_KI270712v1_random:105565-105587 GGCGGAGAGGCGGCCGGCGTCGG + Intergenic
925984882 2:9207276-9207298 GCGGGAGCGGCGGGCGGGGCTGG - Intronic
926130965 2:10302910-10302932 GCCGCGGCGGCGGCGGGCAGCGG + Intronic
926285182 2:11482609-11482631 CCCCTAGCGGCGGCCGGCGATGG - Intergenic
926914410 2:17878700-17878722 GCCGCCGCGGCGGCAGGCGCGGG + Intronic
927472270 2:23385400-23385422 CCCGCAGCCGCGGCGGCCGCGGG - Exonic
927929157 2:27033086-27033108 GCCTCCTCGGCCGCCGGCGCCGG - Exonic
927990171 2:27442148-27442170 CCCGCTGGGGCGGCCGGGGCGGG + Exonic
928606160 2:32946988-32947010 GCCGCAGCGGGGCCCGGCGAGGG - Exonic
928983218 2:37156918-37156940 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
929126604 2:38528228-38528250 ACAGCGGCGGCGGCCGGCGGGGG - Intergenic
930720286 2:54631467-54631489 GCGGCAGCGGCTGCAGGCCCTGG + Exonic
931355835 2:61537465-61537487 GGCGCGGCGGCGGCGGCCGCGGG - Intronic
932231502 2:70087565-70087587 GTCGCAGGGGCGGGCGGCGGCGG - Exonic
932440371 2:71731085-71731107 CCCGCAGGGGCGCCCGGCGCCGG - Intergenic
932567358 2:72918153-72918175 GCCGCGGCCGCCGCGGGCGCGGG + Exonic
932599301 2:73112883-73112905 GCCGCAGCTGCGGGCTGGGCTGG + Exonic
932607676 2:73175836-73175858 GCGGCGGCGGGGGCGGGCGCTGG + Intergenic
932780208 2:74554634-74554656 CCCCCAGCGGCTGCCGGCGGGGG + Exonic
933666861 2:84971284-84971306 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
934248015 2:90324087-90324109 GCCGCGGCGGCGGCGGCGGCGGG + Intergenic
934290364 2:91686261-91686283 GCCGCAGTGCAGCCCGGCGCCGG - Intergenic
934304215 2:91809036-91809058 GCCGCAGCGGCGGGGGGGGGGGG - Intergenic
934329040 2:92043714-92043736 GCCGCAGCGGCGGGGGGGGGGGG + Intergenic
934467093 2:94273029-94273051 GCGGCAGCGGGGGCGGGGGCGGG + Intergenic
934933214 2:98445119-98445141 GCCGCCGCGGGGGCCGGGGCCGG + Intronic
934966828 2:98731011-98731033 GCGGCAGCGGCGGCGCGCGGGGG - Intronic
935301475 2:101697415-101697437 GCCGCGCCGGCGGGCAGCGCGGG - Intronic
938273022 2:129992528-129992550 GCTGCCGCCGCCGCCGGCGCTGG - Intergenic
938397759 2:130963621-130963643 GCGGCTGCGGCGGCGGGCGCGGG - Intronic
938407363 2:131039943-131039965 GCCGCTGCGGCGCAGGGCGCGGG + Intronic
938440855 2:131331157-131331179 GCGGCGGCGGCGGCGGGCGCTGG + Intronic
938443202 2:131353578-131353600 GCTGCCGCCGCCGCCGGCGCTGG + Intronic
938909899 2:135876331-135876353 GCGGCAGCGGAGCCGGGCGCCGG - Exonic
939900615 2:147845245-147845267 GCGGCCGCGGCGGCCGCTGCTGG + Intronic
940883355 2:158968658-158968680 GCTGGAGCGGCGGCCGCCTCGGG + Exonic
941020971 2:160407661-160407683 CGCGCGGCGGCGGCCGGCGGGGG + Intronic
941029314 2:160493444-160493466 GCCGCCGCTGCCGCCGCCGCCGG - Exonic
941819129 2:169827517-169827539 GCGGCCGCGGCGGCCGTCGGGGG + Exonic
941819181 2:169827724-169827746 GACGCGGCGGCGGCCGGAGGCGG + Exonic
942241118 2:173964684-173964706 GCCGCCGCCGCCGCCGCCGCCGG - Intronic
942278090 2:174336938-174336960 GGCGCCGCGGCTGCCGCCGCCGG + Exonic
942278205 2:174337481-174337503 GCGGCGGCGGCGGCCTCCGCGGG + Exonic
944273141 2:197805130-197805152 CCCGCCGCGTCGGGCGGCGCCGG - Exonic
944831218 2:203535341-203535363 GCCGCCGCCGCCGCCGCCGCGGG - Exonic
944831251 2:203535487-203535509 GCGGGCGCGGCGGCCTGCGCCGG - Intergenic
945466003 2:210171287-210171309 GCGGCGGCGGCGGCCGGGGCGGG - Exonic
945988170 2:216371464-216371486 GCAGCAGCAGCTGCGGGCGCGGG - Exonic
946191625 2:218010620-218010642 GCAGAGGCGGCGCCCGGCGCCGG + Intergenic
946329582 2:219001841-219001863 GCGGCCGCGGCGGCCACCGCAGG + Intergenic
946404106 2:219483670-219483692 CCCGCAGCAGCCGCTGGCGCAGG - Exonic
946412632 2:219522731-219522753 GCCCCCGCGGCGGCCGGGGAGGG - Intronic
946412640 2:219522740-219522762 GCCGCCGCGGGGGCGGGCGGCGG + Intronic
946431021 2:219627527-219627549 GCCGCCGCCGCCGCCGCCGCCGG - Intronic
947523355 2:230864839-230864861 GGCGCAGGCGCGGCGGGCGCCGG + Intronic
947741664 2:232487583-232487605 GCCGCAGCCGCAGCCGCAGCCGG + Intronic
947754322 2:232550792-232550814 GCCCCAGCGGGGGCGGGCGCGGG - Intronic
948216716 2:236237820-236237842 GGCGCCGCGGCCGCCGGGGCTGG + Exonic
948438002 2:237967024-237967046 GCCGCACCGGCTCCCGGCGGCGG - Intronic
948570114 2:238912562-238912584 CCCGGAGAGGCGGCCGCCGCAGG - Intergenic
1169832431 20:9839062-9839084 GCTGTAGCGGCGGCCGGGGGTGG + Intergenic
1170150508 20:13221729-13221751 CCCGGCGCGGCGGCCGGCGGCGG - Intergenic
1170756916 20:19212877-19212899 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1171013765 20:21522467-21522489 GCCGCAGCGGAGCCCGGCGGTGG - Intergenic
1171034689 20:21705770-21705792 GCAGCGGCGGCGGCAGGCCCTGG + Exonic
1171532492 20:25861779-25861801 GCCGCGGCGGCGGCTGGATCCGG + Intronic
1171532824 20:25863436-25863458 GCCGCGGCGGCGGCTGGATCCGG + Intronic
1172029044 20:31968672-31968694 GCAGCGGCGGCGGTAGGCGCTGG - Exonic
1172062614 20:32196777-32196799 GCCGCAGCTGCCGCCGGCTGAGG + Exonic
1172446092 20:34994233-34994255 GCCGCTGCTGCGCTCGGCGCAGG + Exonic
1172474491 20:35226777-35226799 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1172474534 20:35226895-35226917 GCGGCGGCGGCGGCGGGGGCAGG + Exonic
1172609069 20:36236028-36236050 GCAGCAGCGGAGGCTGACGCTGG + Intergenic
1172618731 20:36306491-36306513 GCGGCCGAGGCGCCCGGCGCAGG + Exonic
1172644519 20:36461519-36461541 GCGGCGGCGGCGGCCAGCGGCGG - Intronic
1173243425 20:41317580-41317602 GCCGGGCGGGCGGCCGGCGCAGG + Intronic
1173672866 20:44810279-44810301 GCGGCCGAGGCGCCCGGCGCCGG - Intronic
1173820161 20:46014281-46014303 GCCGCCGCGGCCGCCGGCAGGGG + Intronic
1173939096 20:46894832-46894854 GCCGCGGCTGCTGCCTGCGCCGG - Exonic
1174231118 20:49046343-49046365 GGCGGAGCGGCGGCAGGAGCGGG + Exonic
1174287770 20:49484197-49484219 GCCGCCGCCGCCGCCGCCGCGGG - Intergenic
1174380710 20:50153730-50153752 GCCGCCGCCGCGCCCGGCGCTGG - Exonic
1174504785 20:51010191-51010213 GGCGCAGCGGCTGCGGCCGCAGG - Exonic
1174611665 20:51802287-51802309 GCCCCAGCGGCGCCCGCGGCGGG - Exonic
1175149860 20:56925245-56925267 GCCGGAGCGGCGGCGGGCGCGGG + Intergenic
1175429102 20:58890247-58890269 GCCGCGGCGGCGGCGGCCTCGGG - Intronic
1175429374 20:58891238-58891260 GCCGCGGCGGCGGCGGCGGCTGG - Intronic
1175429523 20:58891673-58891695 GCTGCGGCGGCGGCGGGCGCGGG - Intronic
1175806252 20:61830730-61830752 GCGGCAGGAGCGGGCGGCGCTGG + Intronic
1175847108 20:62065008-62065030 GCGGCGGGGGCGGCGGGCGCGGG + Exonic
1175847463 20:62066088-62066110 GCAGCAGCGGCGGGAAGCGCGGG + Intergenic
1175931090 20:62494057-62494079 GCCCCAGCGGCTGCAGGAGCAGG - Intergenic
1175944137 20:62550977-62550999 GCGGCAGCGGCGGCGGGCGCAGG - Exonic
1175962264 20:62643013-62643035 TCGGCAGCAGCGGCCGCCGCAGG - Exonic
1176016800 20:62938112-62938134 GCCGCGGCGGAGGCGGGGGCGGG - Exonic
1176062254 20:63177610-63177632 GCGGCGGCGGCGGCGGGCGCGGG + Intergenic
1176157016 20:63627009-63627031 GCTGCGGCGGCGGCGGGCGGCGG + Intronic
1176157017 20:63627012-63627034 GCGGCGGCGGCGGGCGGCGGCGG + Intronic
1176235138 20:64050395-64050417 GCTGCAGCGGTGGCCTGGGCTGG - Intronic
1176380746 21:6111156-6111178 GCAGCAGCGGCGGCGGCAGCCGG + Exonic
1176380777 21:6111270-6111292 GCGGCAGCGGCGGCAGCGGCGGG + Intronic
1176414631 21:6467579-6467601 GCGGGGGCGGAGGCCGGCGCCGG + Intergenic
1176550023 21:8217026-8217048 GGCCCCGCGGCGGCCGCCGCCGG - Intergenic
1176550167 21:8217364-8217386 GCGGCGGCGGCGGCGGGCGGCGG + Intergenic
1176550168 21:8217367-8217389 GCGGCGGCGGCGGGCGGCGGAGG + Intergenic
1176569095 21:8400402-8400424 GCGGCGGCGGCGGCAGGCGGCGG + Intergenic
1176577009 21:8444634-8444656 GCGGCGGCGGCGGCGGGCGGCGG + Intergenic
1176577010 21:8444637-8444659 GCGGCGGCGGCGGGCGGCGGAGG + Intergenic
1177011054 21:15730367-15730389 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
1178334670 21:31732280-31732302 GCCGCGGCCGCCGCCGCCGCCGG - Intergenic
1178487051 21:33025862-33025884 GCGGCAGCGGTGGCGGGGGCGGG - Intronic
1178513901 21:33230149-33230171 GCCCCAGCCGCGCCCGGCTCTGG - Exonic
1179375463 21:40846773-40846795 GCGGCGGCGGCGGCGGGCGGCGG - Exonic
1179519482 21:41932689-41932711 GCCGCAGCCGCGGCTGGGCCGGG + Intronic
1179674905 21:42974745-42974767 GCAGCGGCGGCGGCGGGCGGCGG - Intronic
1179690129 21:43075901-43075923 GCGGGGGCGGAGGCCGGCGCCGG + Exonic
1179742695 21:43426970-43426992 GCGGCAGCGGCGGCAGCGGCGGG - Intronic
1179742726 21:43427084-43427106 GCAGCAGCGGCGGCGGCAGCCGG - Exonic
1180018173 21:45101078-45101100 GCCGCGGCGGCGGCCGCTGCCGG + Intronic
1180090520 21:45531533-45531555 GGCGCAGCTGCGGCCGCCGCAGG + Exonic
1180462055 22:15573602-15573624 ACCGCTGCGGCCGCCGCCGCTGG + Intergenic
1180871632 22:19150074-19150096 GCAGCAGCAGCAGCAGGCGCAGG + Exonic
1180960688 22:19761050-19761072 GCGGCGGCGGCGGCGGGCCCGGG - Exonic
1181026854 22:20131826-20131848 GCCGCCGCCGCCGCCGCCGCGGG + Intronic
1181155512 22:20917647-20917669 GCCGCAGCGGAGGCCACCCCGGG - Exonic
1181299183 22:21867412-21867434 GCGGCGGCGGCGGCGGGCGCGGG - Exonic
1181586816 22:23857175-23857197 CCGGCAGTGGCGACCGGCGCAGG + Intronic
1181695970 22:24592969-24592991 GCCGGGGCGGCGGCCGGCTGCGG - Exonic
1182294946 22:29307101-29307123 GCCCCAGCGGGGGCCGGAGCCGG - Exonic
1182475520 22:30574589-30574611 GCGGCAGCGGCGGCGGGGGCGGG - Intergenic
1182586363 22:31346213-31346235 GCGGCGGCGGCGGCTGGAGCGGG + Exonic
1183546060 22:38455356-38455378 GGCGCAGCGGGGGACGGCGGCGG - Intergenic
1183548507 22:38468028-38468050 GCCAGGGCGGCCGCCGGCGCAGG - Intergenic
1183607060 22:38872068-38872090 TCCGCAGCCGGGGCCGGGGCCGG - Intronic
1183607099 22:38872224-38872246 GCCGCACCGGCCGCGGGCGCAGG - Exonic
1184046736 22:41976792-41976814 GCAGCGGCGGCGGCTGGCGGCGG + Exonic
1184164784 22:42720802-42720824 GCTCCAGCGGCGGCGGGCGGCGG + Intronic
1184412244 22:44331924-44331946 GCGGCGGCGGCGGCGAGCGCGGG - Intergenic
1184472189 22:44702279-44702301 CCCGGCGGGGCGGCCGGCGCGGG + Intronic
1184782953 22:46658254-46658276 GCGGCAGCGGCGGATGGAGCTGG + Exonic
1184794977 22:46726912-46726934 GCCGCAGCGGAGGCAAGGGCTGG - Intronic
1185301634 22:50084014-50084036 GCTGCAGGGGCTGCCGGCGGAGG + Intronic
1185335799 22:50270391-50270413 GCGGCGGCGGCGGGCGGGGCGGG + Exonic
1185409458 22:50674481-50674503 GCCGGGGCCGGGGCCGGCGCGGG - Intergenic
1203238464 22_KI270732v1_random:30911-30933 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
1203254913 22_KI270733v1_random:133352-133374 GGCCCCGCGGCGGCCGCCGCCGG - Intergenic
1203255062 22_KI270733v1_random:133702-133724 GCGGCGGCGGCGGCGGGCGGCGG + Intergenic
1203255063 22_KI270733v1_random:133705-133727 GCGGCGGCGGCGGGCGGCGGAGG + Intergenic
1203262969 22_KI270733v1_random:178431-178453 GGCCCCGCGGCGGCCGCCGCCGG - Intergenic
1203263118 22_KI270733v1_random:178781-178803 GCGGCGGCGGCGGCGGGCGGCGG + Intergenic
1203263119 22_KI270733v1_random:178784-178806 GCGGCGGCGGCGGGCGGCGGAGG + Intergenic
949987526 3:9552700-9552722 GCGGCGGCGGCGGCTGGCGGGGG + Exonic
950549085 3:13655483-13655505 GCCGCAGCGGCCCCTGGCGGCGG - Intergenic
951208321 3:19947260-19947282 GCCGCCGCCGCCGCCGGCGCTGG - Exonic
951981969 3:28575977-28575999 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
952382916 3:32818293-32818315 GGCGCACCGGCTGCCGGCGGCGG + Exonic
952796434 3:37243295-37243317 GCCGCCGCGGCTCCCGGGGCTGG + Exonic
952867193 3:37862007-37862029 GCGGCGGCGGCGGCGGGAGCTGG + Intronic
953027535 3:39153600-39153622 GGCGGAGCGGCGGGCGGGGCTGG - Intronic
954025726 3:47781772-47781794 GCCGCAGCGGCGGGCGGCGGCGG - Exonic
954063637 3:48088964-48088986 GCCGGAGCGGCGGCGCTCGCCGG - Exonic
954138962 3:48595279-48595301 GCAGCGGCGGCGGCGGGAGCGGG - Intergenic
954301907 3:49704759-49704781 GCCGCAGTGGGGGCAGGCGGTGG + Intronic
954468869 3:50674948-50674970 GCCGCGGCGGCGCCGGGAGCCGG + Intergenic
954615554 3:51967340-51967362 GCCGCCGCCGCCGCCGCCGCAGG - Exonic
954618629 3:51983386-51983408 GCCGACGCGGCCGCTGGCGCCGG + Exonic
954715452 3:52524553-52524575 GCTGCAGCGGCGTACGGCGTGGG + Exonic
955387610 3:58492063-58492085 GCCGCCGCCGCCGCCGTCGCCGG + Intergenic
955911574 3:63863959-63863981 GCCGCCGCCGCCGCCGCCGCGGG + Intergenic
955911611 3:63864056-63864078 GCTGCAGCCGGGGCCGCCGCCGG - Intergenic
956659485 3:71583797-71583819 GCCGCCGCCGCCACCGGCGCTGG - Intronic
961736276 3:129003890-129003912 GCTGCGGCGGAGGCCCGCGCTGG + Exonic
961827165 3:129605278-129605300 GCGGCGGCGGCGGCGGGGGCGGG - Intronic
962301862 3:134250564-134250586 GCAGCAGCGGCGGCGGCGGCGGG + Exonic
962318746 3:134374471-134374493 GCCCCAGGGTCGGCCCGCGCCGG + Intronic
963253356 3:143121096-143121118 GCCGCAGCGGGGGCAGCCGGAGG + Exonic
964720624 3:159764768-159764790 GCAGCGGCGGCGGCGGGGGCAGG + Exonic
964771286 3:160226114-160226136 GTGGCGGCGGCGGCCGGGGCCGG + Exonic
966182199 3:177197561-177197583 GCCGCCGCCGCCGCCGCCGCGGG - Intergenic
966696408 3:182793906-182793928 GCCGCAGCGGAGACGGGCGCGGG + Intronic
966849407 3:184155455-184155477 GCGGCGGCGGCGGGCGGCGCTGG + Exonic
967858511 3:194135078-194135100 GCCGCGGCTGCGGCCGGGCCGGG - Intergenic
968323457 3:197791578-197791600 GCCGGGGCGGCTCCCGGCGCCGG - Intronic
968434135 4:576267-576289 GCCGCATCGGTTCCCGGCGCGGG - Intergenic
968583759 4:1406526-1406548 GGAGCAGCGGCCGCCTGCGCGGG - Intergenic
968584765 4:1411104-1411126 GCTGCAGAGGCGGCCGCGGCTGG + Intergenic
968701300 4:2059401-2059423 GCCGCCGCCGCCGCCGCCGCGGG + Intergenic
968894089 4:3388654-3388676 GCAGCAGGGGCTGCAGGCGCTGG - Intronic
969379106 4:6782804-6782826 GGCGGCGCGGCGGCCGGCGGGGG - Exonic
969394211 4:6910023-6910045 GCTGCAGCGCCGGCCGAGGCGGG + Intronic
969413348 4:7043451-7043473 GCAGCCGCGGCGGCGGGCGGCGG + Exonic
969492930 4:7510285-7510307 CCCGAATCGGGGGCCGGCGCAGG - Intronic
969619066 4:8269882-8269904 GCCGCTGCGGGGCCGGGCGCCGG - Exonic
970333015 4:15003728-15003750 GCGGCGGCGGCGGCGGGGGCGGG + Exonic
971451370 4:26804674-26804696 GCCGCGGAGGCGGCGGGCCCGGG + Intergenic
971757563 4:30721988-30722010 GCGGCAGCGGCGGCGAGAGCCGG + Exonic
972321550 4:37977358-37977380 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
972396657 4:38664103-38664125 GCCGCCGCGGCCGCCCGGGCTGG - Intergenic
972632880 4:40857190-40857212 GCGGCCGCGGCGGGCGGGGCAGG - Intronic
972725774 4:41745776-41745798 GCCGCCGCCGCCGCCGCCGCAGG + Exonic
972765789 4:42151698-42151720 GCGGCGGCGGCCGCCGGCACCGG - Exonic
972960614 4:44448266-44448288 CCCGTGGCGGCGCCCGGCGCCGG - Exonic
973636023 4:52862547-52862569 GCCGCGGCGTTGCCCGGCGCGGG - Exonic
974047559 4:56909340-56909362 GCCGCCGCCGAGGCAGGCGCTGG + Intronic
975870852 4:78776626-78776648 GCCGGAGCCGCAGCCGGCCCCGG - Exonic
975986258 4:80203236-80203258 GCGGCTGCGGCGGCGGCCGCGGG + Exonic
976367205 4:84245144-84245166 GCCGCAGCTGCCGCCGGCTGAGG - Intergenic
976390020 4:84497712-84497734 GCGGCGGCGGCGGCGGGCTCAGG + Exonic
976593929 4:86876342-86876364 AGCGCAGCGACGGCCGGGGCCGG + Intronic
976743330 4:88379088-88379110 GCCGCAGGGGCGCGCAGCGCGGG + Exonic
977574072 4:98658695-98658717 GGCGGAGCTGCGGGCGGCGCGGG - Intergenic
978503579 4:109433951-109433973 GCCGCAGCGCCCGCGGGCCCGGG + Exonic
978777208 4:112516028-112516050 GCGGCGGCGGCGGCCCGCCCGGG + Exonic
981128400 4:141132618-141132640 GCCGGGGCGGCGGGCGGCGGCGG - Exonic
981270747 4:142845728-142845750 GCCGCCGCCGCCGCCGCCGCCGG - Intronic
981550599 4:145937734-145937756 GCGGCGGCGGCGGCTGGAGCAGG - Intronic
981550600 4:145937740-145937762 GCGGCAGCGGCGGCGGCGGCTGG - Intronic
983238709 4:165207708-165207730 GCCGCGGGGGCCGCCGCCGCAGG + Intronic
983940160 4:173529182-173529204 GCTGCAGCGGCTGGCGGCGGCGG + Exonic
984206505 4:176792890-176792912 GCGGCGGCGGCGGCGGGCGCAGG + Intergenic
984952613 4:185018474-185018496 GGCGCAGCGGCCGCGGGCACCGG - Intergenic
985550118 5:528587-528609 GCAGCAGAGGCGTCCGGGGCGGG - Intergenic
985727554 5:1523996-1524018 GCGGGAGCGCCGGCCGGGGCGGG + Intergenic
985757704 5:1729068-1729090 ACTGCAGGGGCGGCCGGCTCCGG + Intergenic
985773586 5:1828017-1828039 GCCGCAGCGGGAGCCGGAGCAGG + Intergenic
985996708 5:3600910-3600932 GACGCAGCGCCGGGCGACGCCGG - Intronic
986330464 5:6713471-6713493 GCCGCCGCCGCCGCCGCCGCAGG + Intergenic
986813659 5:11385160-11385182 GCCGCCGCCGCCGCCGCCGCGGG - Exonic
986859023 5:11904513-11904535 GCGGCAGCAGCGGCAGCCGCGGG + Intergenic
988825299 5:34929659-34929681 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
990955145 5:61332804-61332826 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
991676557 5:69094287-69094309 GCCGCCGCCGCCGCCGGGGCCGG - Exonic
992473184 5:77077508-77077530 GCCGCAGCGGGGCCGGGCGGCGG + Exonic
992866289 5:80960420-80960442 GGCGAAGCGGCGGCCGGCTCGGG + Intergenic
995512330 5:112921836-112921858 GCAGCTGCGGCGCCGGGCGCTGG - Intronic
996862822 5:128084261-128084283 GCAGCGGCGGCGGCTGGTGCTGG + Exonic
997505276 5:134411982-134412004 CCCGGAGCGGCGGCCTGCGGGGG + Intergenic
997521302 5:134525944-134525966 GCCGCTGCAGGGACCGGCGCGGG - Intronic
997975415 5:138439078-138439100 GCCGCTGCAGCAGCCGCCGCGGG - Exonic
998406682 5:141878272-141878294 GCCGCAGCCCAGGCCGGGGCCGG - Exonic
999731195 5:154477806-154477828 GCTGCAGCGGCCGCGGGCGGCGG + Exonic
1001506371 5:172283712-172283734 GCTGCAGCGGCGGCGGCGGCGGG - Exonic
1001563209 5:172683586-172683608 GCCGCGGCGTCGGCTGGCGGTGG - Exonic
1002058064 5:176610039-176610061 GCGGCGGCGGCGGCGGGAGCCGG - Exonic
1002064898 5:176647194-176647216 AACGCGGCGGCGGCCTGCGCGGG + Intergenic
1002661178 5:180792068-180792090 GCCGGAGCAGCGGCAGGGGCGGG - Exonic
1002895678 6:1378800-1378822 GCCGCGGCGCCGGCCGCAGCCGG - Intergenic
1002897953 6:1390035-1390057 GCGGCGGCGGCGGCGGGCGGCGG - Exonic
1002925803 6:1605087-1605109 GCCGCAGCGGACCCAGGCGCCGG - Intergenic
1002927003 6:1610530-1610552 GCGGCCGCGGCGGCCGGGGGCGG + Exonic
1002927346 6:1611910-1611932 GCGGCGGCGGCGGCGGCCGCAGG + Exonic
1002927867 6:1615098-1615120 GCCGCAGCGCCGGCCCGGGCAGG - Intergenic
1003049415 6:2766049-2766071 CCCGCCGCGGCGGCGGCCGCCGG - Exonic
1003074406 6:2971149-2971171 ACGGAAGAGGCGGCCGGCGCGGG - Intronic
1003345269 6:5260920-5260942 GCCGCTTCGGGGGCGGGCGCAGG + Intronic
1003552005 6:7108393-7108415 GGCGCTGCGGCGGCTCGCGCTGG - Intronic
1003624091 6:7727052-7727074 GCTGCCGCGGCCGCCGCCGCCGG + Exonic
1003645545 6:7910675-7910697 GCCATGGCGGCGGCGGGCGCTGG - Exonic
1004140564 6:13013849-13013871 GCCGGAGCAGCGCCCGGCCCCGG + Intronic
1004395894 6:15246048-15246070 GCCGCCGCCGCCGCCGCCGCTGG + Intergenic
1004562123 6:16760985-16761007 GGCGCAGGGGCGGCCGGCGGGGG - Intronic
1006458678 6:34145708-34145730 GCAGCAGCGGCTGTGGGCGCCGG - Intronic
1006472511 6:34236747-34236769 GCGGCAGCGGCGGCGGCGGCTGG + Intergenic
1006725501 6:36196794-36196816 GCGGCGGCGGCGGCCGGGCCGGG + Exonic
1007556574 6:42771264-42771286 GGCGCAGCGGCGGCCCGCAGGGG - Intronic
1007557819 6:42782019-42782041 GCGGCGGCGGCGGCGGGCGCGGG - Exonic
1007600163 6:43076369-43076391 GCCGCAGCAGCAGCCGCAGCCGG - Intronic
1007625405 6:43243676-43243698 GCCGCAGCCGCAGCCGCAGCGGG + Exonic
1007760109 6:44128273-44128295 GCTGGAGAGGCGGCCGGCCCCGG + Intronic
1007784268 6:44270987-44271009 GCGGCTGCAGCGGCCGGCTCGGG - Intronic
1010141921 6:72622250-72622272 GGCGCAGCGGCGGCGGCGGCGGG + Exonic
1010141925 6:72622256-72622278 GCGGCGGCGGCGGCGGGCGGGGG + Exonic
1010569927 6:77463950-77463972 GCTGCAGCGGCCGCCAGAGCTGG + Intergenic
1013349193 6:109290547-109290569 CTCGGAGCGGCGGCCGTCGCTGG - Intergenic
1013459044 6:110358086-110358108 GCCGCACCTGCCGCCCGCGCCGG - Exonic
1013803220 6:113970562-113970584 GCCGCCGCTGGGGACGGCGCCGG - Intronic
1014116786 6:117675584-117675606 TCCGCCCCTGCGGCCGGCGCGGG - Exonic
1014137540 6:117907190-117907212 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
1015149093 6:130019288-130019310 GCCGCCGAGGCGGGGGGCGCCGG + Intronic
1015220638 6:130801496-130801518 GCGGCAGCGGCGGCAGCGGCGGG + Intergenic
1015799335 6:137044683-137044705 GCGGCAGCGGCAGCGGCCGCAGG + Exonic
1016010776 6:139135574-139135596 GCCGGAGGCGCGGCGGGCGCCGG + Exonic
1016329867 6:142945110-142945132 GCGGCTGCGGCGGCCGGCGGCGG - Exonic
1016495770 6:144660053-144660075 GCAGCAGCGGCAGCTTGCGCTGG - Intronic
1016923181 6:149316981-149317003 CCCGCGGCGGAGGCTGGCGCCGG - Intronic
1017163934 6:151390824-151390846 GCAGCAGCGGCGGCAGCAGCAGG + Intronic
1017672281 6:156778840-156778862 GCCGCCGCCGCCGCCCGCGCCGG - Exonic
1017880578 6:158560130-158560152 GCGGCAGCCGCAGCCGGAGCCGG - Intronic
1018156648 6:160991694-160991716 GCGGCGGCGGCGGCGGGCGCCGG - Intergenic
1018400331 6:163414610-163414632 GCCGCTGCTGCCGCCGCCGCTGG + Intronic
1018400494 6:163415143-163415165 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
1018613021 6:165662089-165662111 GCCGCCGCCTGGGCCGGCGCCGG + Intronic
1018613069 6:165662233-165662255 GCAGCGGCGGCGGGCGGCGGCGG - Intronic
1018613070 6:165662236-165662258 GTGGCAGCGGCGGCGGGCGGCGG - Intronic
1018795507 6:167182149-167182171 GCCGCAGCCGCAGCCGCAGCAGG - Exonic
1018820814 6:167372914-167372936 GCCGCAGCCGCAGCCGCAGCAGG + Exonic
1019111917 6:169723981-169724003 GCGGCAGCGGCGGCGGCGGCCGG - Exonic
1019309720 7:354071-354093 GCTGCAGGGGCGGCCAGTGCGGG + Intergenic
1019379236 7:712532-712554 GCAGCAGCTGCGCGCGGCGCGGG - Intronic
1019474247 7:1236432-1236454 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
1019515196 7:1436818-1436840 GCAGGAGCGGCGGCGGGAGCAGG - Exonic
1019536120 7:1530732-1530754 GCGGTGGCGGCGGGCGGCGCGGG + Exonic
1019666968 7:2256841-2256863 GCCGAGACGGCGGCCGGAGCAGG + Intronic
1019716497 7:2541751-2541773 GCGGCACAGGAGGCCGGCGCAGG + Exonic
1019942614 7:4303118-4303140 GCCGCAGCGGGGGGCAGGGCTGG - Intergenic
1019989560 7:4682263-4682285 GCCGCTGCAGCCGCCGCCGCCGG + Intergenic
1020105726 7:5421417-5421439 GGCGCACAGGCGGCCGGCGGTGG + Exonic
1020178101 7:5898803-5898825 GCTGCAGCGGCGGCCGGGGCCGG + Exonic
1020274295 7:6615503-6615525 GCGGCGGCGGCGGCGGGGGCCGG + Intergenic
1020304826 7:6826172-6826194 GCTGCAGCGGCGGCCGGGGCCGG - Exonic
1021163057 7:17299169-17299191 ACCACTGCGGCGGCCGGCGCCGG - Exonic
1021452778 7:20798060-20798082 GCTGCGGCGGCCGCGGGCGCGGG + Intergenic
1021600225 7:22356990-22357012 GCCGCCGCGGCGGCCAGGGCCGG + Intronic
1022106161 7:27199467-27199489 GCGGCGGCGGCGGCCGAGGCGGG + Exonic
1022106222 7:27199716-27199738 GCAGCAGCGGCGGCAGCCGACGG + Exonic
1022106286 7:27199917-27199939 GCGGCGGCGGCTGCCGGGGCCGG - Exonic
1022106289 7:27199923-27199945 GCTGCAGCGGCGGCGGCTGCCGG - Exonic
1022107181 7:27204989-27205011 GCCGCTGCCGCGGCTGCCGCCGG - Intergenic
1022698068 7:32728908-32728930 GCGGCGGCGGCGGCCAGCACCGG + Intergenic
1022739726 7:33109417-33109439 GCCGCCGCCGCCGCCGCCGCCGG - Intergenic
1023418298 7:39951393-39951415 GCAGCAGCAGCGGCGGCCGCCGG + Exonic
1023638419 7:42236481-42236503 GCCGCGGGGGCCGCCGCCGCTGG - Intronic
1024520967 7:50304121-50304143 GCCGGGGCGGCGGCGGGTGCGGG - Intronic
1025069780 7:55887841-55887863 GCGGCGGCGGCGGCGGGCGGCGG + Intronic
1025069792 7:55887873-55887895 GCGGCGGCGGCGGCGGGCGGCGG + Intronic
1025069793 7:55887876-55887898 GCGGCGGCGGCGGGCGGCGGCGG + Intronic
1025078769 7:55964770-55964792 GCCGGGGCGGAGACCGGCGCCGG - Intronic
1026732648 7:72925131-72925153 GCGGCTGCGGCGGCTGGAGCAGG + Intronic
1026850174 7:73719103-73719125 CCCGCAGCGGGGCCCCGCGCAGG + Intronic
1027111416 7:75442688-75442710 GCGGCTGCGGCGGCTGGAGCAGG - Intronic
1027233058 7:76283011-76283033 GCGGGAGCGGCGCCGGGCGCGGG - Exonic
1027283645 7:76627221-76627243 GCGGCTGCGGCGGCTGGAGCAGG - Exonic
1028198481 7:87934335-87934357 GCCGCAGCACCGGCCGGGGCTGG + Intronic
1028477085 7:91264805-91264827 GCCGCAGGGGGAGCCGCCGCCGG + Exonic
1028922403 7:96322268-96322290 GCCGCAGAGGCCGCCGCTGCTGG - Intergenic
1029080757 7:97972229-97972251 GCTGCAGCGGCGGCCGGGGCTGG - Intergenic
1029123214 7:98281767-98281789 GCCGGAGCGGCGGGCGCGGCCGG + Exonic
1029276567 7:99408632-99408654 GCGGCGGCGGCGGCTGGCCCAGG - Exonic
1029461029 7:100694033-100694055 GCCGCCGCGGCGTCGGGGGCGGG + Intergenic
1029495972 7:100895665-100895687 GGGGCAGCGGAGGGCGGCGCGGG + Intronic
1032020693 7:128405910-128405932 GCAGCAGCGGCGGCAGCGGCGGG - Intronic
1032345167 7:131110056-131110078 GCGGCGGCGGCGGCCGGAGCTGG + Intergenic
1032387485 7:131534509-131534531 GCCACAGGGGTGGCCGGCGGGGG + Intronic
1033214294 7:139482852-139482874 GCGGCGTCGGCTGCCGGCGCAGG + Intronic
1034243139 7:149624710-149624732 GACGCAACTGCGGGCGGCGCAGG - Intergenic
1034270651 7:149802110-149802132 GCCGCAGCAGCTCCTGGCGCTGG - Intergenic
1034339397 7:150341909-150341931 TCCGCAGCCTCGGCCGGCCCGGG + Intergenic
1034435042 7:151059519-151059541 GCGGGAGCGGGGGCCGGGGCGGG - Intronic
1034446141 7:151115185-151115207 GCCGCCGAGGCGCCGGGCGCGGG + Intronic
1034455499 7:151167812-151167834 GGCGCGGCGGCGGCGGGCGGAGG - Intronic
1034483542 7:151341738-151341760 GCGACAGCGGCGGCGGGGGCGGG + Exonic
1034800481 7:154052657-154052679 GGAGGAGCGGCCGCCGGCGCTGG + Intronic
1034977715 7:155457900-155457922 GCGGCGGCGGCGGCCGGAGCCGG + Intergenic
1035167921 7:157002665-157002687 GTCGCAGTGACGGCCGCCGCAGG + Intronic
1035169541 7:157009947-157009969 GCCGCCGCCGCCGCCGCCGCTGG - Exonic
1035553018 8:544663-544685 GCGGCGGCGGCGGCCGGTGGCGG + Exonic
1036390282 8:8318839-8318861 GGCGCGGCGGCGGCGGGGGCGGG + Exonic
1036561612 8:9904024-9904046 TCGGCAGCGGCAGCCGGGGCAGG + Intergenic
1036723697 8:11200976-11200998 GCCGGAGCCGCCGCCGCCGCAGG - Exonic
1037262892 8:17027484-17027506 GTGGCGGCGGCGGCCGGCGGGGG + Exonic
1037888009 8:22605083-22605105 GCCTCAGCAGCCGCCAGCGCCGG - Intronic
1038543924 8:28411693-28411715 TTCCCGGCGGCGGCCGGCGCGGG - Intronic
1038633039 8:29263229-29263251 GCCGCAGCGAAGGCGGGGGCGGG + Intergenic
1040415238 8:47189238-47189260 GCTGCTGCGGCGGCCGCGGCCGG - Intergenic
1041059500 8:54022274-54022296 GCCGCCGCCGCCGCCGCCGCGGG - Exonic
1041355299 8:56993630-56993652 GCGGCGGCGGCGGCGGGCGCTGG - Exonic
1041552638 8:59118941-59118963 GGCGCAGCGGCGGGCTGGGCTGG + Exonic
1041552680 8:59119259-59119281 GCCGCCGCTGCCGCCGCCGCCGG + Intergenic
1042155687 8:65841955-65841977 GCGGCGGCGGCGGCCCGAGCTGG - Intronic
1042155691 8:65841973-65841995 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1042532864 8:69833000-69833022 GCCGCCGCCGCCGCCGCCGCTGG + Exonic
1042785094 8:72537380-72537402 GCAGCGGCGGCGGCGGCCGCGGG - Exonic
1044629161 8:94262311-94262333 GCCGCGGCGGCTGCAGGCGGCGG - Exonic
1045114979 8:98972558-98972580 CCCGCAGCCGCGGCCCGGGCGGG + Intergenic
1045222579 8:100213263-100213285 GCGGCGGCGGCGGCGGGCGGCGG + Exonic
1045738014 8:105318843-105318865 GCCGCCGCCGCCGCCGCCGCTGG - Exonic
1047381879 8:124372084-124372106 GCGGCGGCGGCGGCCGGGCCCGG + Exonic
1047499623 8:125431122-125431144 GCCGCTCCGGGGGCCGGCGGAGG + Exonic
1048991497 8:139762971-139762993 GCTGCAGCTGCAGCCGGGGCAGG + Intronic
1049405309 8:142449679-142449701 GCGGCGGCGGCGGCCGGAGAGGG + Exonic
1049406227 8:142452866-142452888 GCCGCAGTGGCGGAAGGCGGAGG + Intronic
1049628210 8:143636185-143636207 GCCGCAGCCCCGGCTGGCTCCGG + Intronic
1049659964 8:143815508-143815530 GACGCGGCCGCGGCCGGCGCTGG + Intergenic
1049660681 8:143818507-143818529 GGCTCAGCGGCAGCGGGCGCTGG - Exonic
1049680609 8:143916309-143916331 GCCGCGGCGGGAGCCGGCCCGGG + Exonic
1049681182 8:143919075-143919097 GCCGCCGTGGCTGCCGCCGCCGG + Exonic
1049694299 8:143976106-143976128 GCCGCAGCGGCGTGGGCCGCGGG + Intronic
1049721181 8:144116206-144116228 GCCGCGGGGGCAGCGGGCGCGGG - Exonic
1049761512 8:144333936-144333958 CCCGCAGCGGTGGCCAGCTCCGG + Exonic
1049762275 8:144336904-144336926 GCGGCGGCGGCGGCGGGCGGGGG + Intergenic
1049788434 8:144462359-144462381 GCGGCGGCGGCGGCCGGCAGCGG - Intronic
1051641781 9:19230609-19230631 GCCGGAGCGCTGGCCCGCGCGGG - Exonic
1051855500 9:21559898-21559920 GTCGCGGCGGCGGCTGGAGCGGG - Intergenic
1051896407 9:21994201-21994223 GCCACAGCGGCGGGCGCCCCTGG + Intronic
1052362157 9:27573213-27573235 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1053114608 9:35490118-35490140 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1053786372 9:41655359-41655381 GCGGCTGCGGAGGCTGGCGCGGG - Intergenic
1054158691 9:61658858-61658880 GCGGCTGCGGAGGCTGGCGCGGG + Intergenic
1054175091 9:61869315-61869337 GCGGCTGCGGAGGCTGGCGCGGG - Intergenic
1054440858 9:65258895-65258917 GCCGCGGCGGCGGCGGGGGGGGG + Intergenic
1054478465 9:65589863-65589885 GCGGCTGCGGAGGCTGGCGCGGG + Intergenic
1054489419 9:65762592-65762614 GCCGCGGCGGCGGCGGGGGGGGG - Intergenic
1054662446 9:67711478-67711500 GCGGCTGCGGAGGCTGGCGCGGG + Intergenic
1054775658 9:69121697-69121719 GCCGCGGCGGCGGCCGCCACCGG + Intronic
1054835570 9:69672286-69672308 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1055000730 9:71446731-71446753 GCCGGAGCGCCAGCCGGGGCAGG - Intronic
1055090863 9:72364381-72364403 TCCGCGGCGGCGCCCGGCGTGGG - Intronic
1057245540 9:93451700-93451722 GCGGCAGCGGCGGCGGCGGCAGG + Exonic
1057315748 9:93967235-93967257 GCATCAGCCGCAGCCGGCGCTGG - Intergenic
1057488631 9:95506091-95506113 GCGGCAGCGGCGGCGGGCCCGGG + Intronic
1057488935 9:95507369-95507391 GCCGGGGCCGCGGCCAGCGCCGG - Intronic
1057489145 9:95508368-95508390 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
1057600049 9:96450129-96450151 GGCGCCGCGGGGGCGGGCGCCGG + Intergenic
1057600119 9:96450420-96450442 GCTGCAGCTGCTGCTGGCGCCGG - Exonic
1057600130 9:96450460-96450482 GCGGCGGCGGCGGCCGGGGCCGG + Exonic
1057600133 9:96450473-96450495 GCCGCCGCGGGGACCGGCCCCGG - Exonic
1059633937 9:116154346-116154368 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1060389890 9:123268525-123268547 GCCGCCGCAGCCGCCGCCGCTGG - Intronic
1060700603 9:125746944-125746966 GCGGCGGCGGCGGGCGGCGGCGG - Intergenic
1060700604 9:125746947-125746969 GCGGCGGCGGCGGCGGGCGGCGG - Intergenic
1060700938 9:125748014-125748036 GCGGCCGCGGGAGCCGGCGCCGG - Intronic
1060713081 9:125889935-125889957 GCAGCCGGGGCCGCCGGCGCGGG - Intronic
1061250016 9:129421110-129421132 GCGGCATCGGCGGGTGGCGCTGG - Intergenic
1061450195 9:130663551-130663573 GCCGCAGCGGCCGTCGGGGCTGG - Intergenic
1061453494 9:130681598-130681620 GCGGCGGCGGCGGCGAGCGCGGG - Exonic
1061672799 9:132198514-132198536 GCGGCTGCTGCGCCCGGCGCTGG + Exonic
1061828328 9:133275268-133275290 GTCGGGGCGGCGGGCGGCGCGGG - Intergenic
1061866662 9:133494855-133494877 GACGCAGGGGAGGCCGGGGCTGG - Intergenic
1062065874 9:134525938-134525960 GCCGCAGCGCAGGCTGCCGCCGG - Intergenic
1062452611 9:136621875-136621897 CCACCTGCGGCGGCCGGCGCTGG - Intergenic
1062537633 9:137027896-137027918 GCCGCAGCGCCGGCAGGCGAGGG + Exonic
1062574608 9:137200368-137200390 GCCCCCGGGGCGGGCGGCGCGGG + Exonic
1062575509 9:137205493-137205515 GCAGCAGCGGCGGCAGGCGCGGG - Exonic
1062594826 9:137294952-137294974 GCAGCAGAGGAGGCCGGCGCTGG - Intergenic
1202779998 9_KI270717v1_random:24911-24933 GCCGCGGCGGCGGCGGGTGGCGG + Intergenic
1203794642 EBV:169893-169915 GCGGGAGCGGGGGGCGGCGCGGG + Intergenic
1203794843 EBV:170431-170453 GCGGGAGCGGGGGGCGGCGCGGG + Intergenic
1203795034 EBV:170954-170976 GCGGGAGCGGGGGGCGGCGCGGG + Intergenic
1203795235 EBV:171492-171514 GCGGGAGCGGGGGGCGGCGCGGG + Intergenic
1203471460 Un_GL000220v1:116839-116861 GCGGCGGCGGCGGCAGGCGGCGG + Intergenic
1203479281 Un_GL000220v1:160811-160833 GCGGCGGCGGCGGCAGGCGGCGG + Intergenic
1187518154 X:19990952-19990974 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
1189137116 X:38561504-38561526 GCGGCGGCGGCGGCAGGCGGCGG - Exonic
1189137119 X:38561513-38561535 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1189323300 X:40098594-40098616 GCGGCAGCGGCTGCTGCCGCTGG - Intronic
1189398942 X:40647332-40647354 GCCGCCGCGGCAGACGGCGCGGG + Exonic
1190149891 X:47936675-47936697 GCGGCAGGGGCGGGCGGCGGGGG + Intronic
1190266888 X:48831968-48831990 GCCGCGGCGGGGACGGGCGCGGG + Exonic
1190285222 X:48957197-48957219 GGCGCAGCGGCGGCGGGTGTGGG - Exonic
1190304485 X:49074253-49074275 GCCCCTGCGGCGCCCCGCGCGGG - Intronic
1190542864 X:51496501-51496523 GCCGCTGCCGCTGCCGCCGCCGG + Exonic
1190712926 X:53082570-53082592 GCGGCGGCGGCGGCGGGGGCGGG - Exonic
1190881627 X:54495931-54495953 GCCGCAGCCGAGGCCGGGGGCGG + Exonic
1190988598 X:55522645-55522667 GCCACAGCTGCGGCCGGCCACGG + Intergenic
1194977594 X:100409721-100409743 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
1195702669 X:107716634-107716656 GCCGGGGCGCCGGCCGGAGCTGG - Intronic
1195803302 X:108735941-108735963 GCAGCAGCGGCGGCCGCCTCTGG - Exonic
1195923186 X:110002678-110002700 GCCGCGGCGGCGGCCGCCAGGGG + Intronic
1196684067 X:118495881-118495903 GCAGCGGCCGCGGCCGCCGCGGG + Intronic
1196793233 X:119482756-119482778 GCCGCAGCGGCAGCAGCCGATGG + Intergenic
1199772381 X:150983392-150983414 GCGGCGGCGGCGGCGGGAGCGGG - Intronic
1199772835 X:150984713-150984735 CCCGCAGCGGCGGCCCGGGCGGG - Intronic
1200093842 X:153648145-153648167 GCTGCAGCGGCGGCCCAGGCAGG - Exonic
1200128915 X:153830658-153830680 GCGGCAGCGGCGGGCCCCGCGGG - Intergenic
1200213544 X:154357392-154357414 GCCGCTGCGGCGCTCGGCACGGG - Intronic
1200231076 X:154444194-154444216 GCGGCGGCGGCGGGCGGCGGCGG - Exonic
1200231077 X:154444197-154444219 GCGGCGGCGGCGGCGGGCGGCGG - Exonic