ID: 904783511

View in Genome Browser
Species Human (GRCh38)
Location 1:32968033-32968055
Sequence AAAAGGCATCTGGGTCTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904783511_904783516 10 Left 904783511 1:32968033-32968055 CCAGGTAGACCCAGATGCCTTTT No data
Right 904783516 1:32968066-32968088 CCTTGTGCAGCTGACAGAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904783511 Original CRISPR AAAAGGCATCTGGGTCTACC TGG (reversed) Intergenic
No off target data available for this crispr