ID: 904783512

View in Genome Browser
Species Human (GRCh38)
Location 1:32968042-32968064
Sequence GAAGCATCTAAAAGGCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904783512_904783517 24 Left 904783512 1:32968042-32968064 CCCAGATGCCTTTTAGATGCTTC No data
Right 904783517 1:32968089-32968111 CTGTCAGAATCCCAGCTTGCTGG No data
904783512_904783518 28 Left 904783512 1:32968042-32968064 CCCAGATGCCTTTTAGATGCTTC No data
Right 904783518 1:32968093-32968115 CAGAATCCCAGCTTGCTGGAAGG No data
904783512_904783516 1 Left 904783512 1:32968042-32968064 CCCAGATGCCTTTTAGATGCTTC No data
Right 904783516 1:32968066-32968088 CCTTGTGCAGCTGACAGAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904783512 Original CRISPR GAAGCATCTAAAAGGCATCT GGG (reversed) Intergenic