ID: 904783513

View in Genome Browser
Species Human (GRCh38)
Location 1:32968043-32968065
Sequence AGAAGCATCTAAAAGGCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904783513_904783518 27 Left 904783513 1:32968043-32968065 CCAGATGCCTTTTAGATGCTTCT No data
Right 904783518 1:32968093-32968115 CAGAATCCCAGCTTGCTGGAAGG No data
904783513_904783516 0 Left 904783513 1:32968043-32968065 CCAGATGCCTTTTAGATGCTTCT No data
Right 904783516 1:32968066-32968088 CCTTGTGCAGCTGACAGAAACGG No data
904783513_904783517 23 Left 904783513 1:32968043-32968065 CCAGATGCCTTTTAGATGCTTCT No data
Right 904783517 1:32968089-32968111 CTGTCAGAATCCCAGCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904783513 Original CRISPR AGAAGCATCTAAAAGGCATC TGG (reversed) Intergenic
No off target data available for this crispr