ID: 904783516

View in Genome Browser
Species Human (GRCh38)
Location 1:32968066-32968088
Sequence CCTTGTGCAGCTGACAGAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904783513_904783516 0 Left 904783513 1:32968043-32968065 CCAGATGCCTTTTAGATGCTTCT No data
Right 904783516 1:32968066-32968088 CCTTGTGCAGCTGACAGAAACGG No data
904783514_904783516 -7 Left 904783514 1:32968050-32968072 CCTTTTAGATGCTTCTCCTTGTG No data
Right 904783516 1:32968066-32968088 CCTTGTGCAGCTGACAGAAACGG No data
904783511_904783516 10 Left 904783511 1:32968033-32968055 CCAGGTAGACCCAGATGCCTTTT No data
Right 904783516 1:32968066-32968088 CCTTGTGCAGCTGACAGAAACGG No data
904783510_904783516 16 Left 904783510 1:32968027-32968049 CCAATTCCAGGTAGACCCAGATG No data
Right 904783516 1:32968066-32968088 CCTTGTGCAGCTGACAGAAACGG No data
904783507_904783516 19 Left 904783507 1:32968024-32968046 CCCCCAATTCCAGGTAGACCCAG No data
Right 904783516 1:32968066-32968088 CCTTGTGCAGCTGACAGAAACGG No data
904783509_904783516 17 Left 904783509 1:32968026-32968048 CCCAATTCCAGGTAGACCCAGAT No data
Right 904783516 1:32968066-32968088 CCTTGTGCAGCTGACAGAAACGG No data
904783512_904783516 1 Left 904783512 1:32968042-32968064 CCCAGATGCCTTTTAGATGCTTC No data
Right 904783516 1:32968066-32968088 CCTTGTGCAGCTGACAGAAACGG No data
904783508_904783516 18 Left 904783508 1:32968025-32968047 CCCCAATTCCAGGTAGACCCAGA No data
Right 904783516 1:32968066-32968088 CCTTGTGCAGCTGACAGAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904783516 Original CRISPR CCTTGTGCAGCTGACAGAAA CGG Intergenic
No off target data available for this crispr