ID: 904783518

View in Genome Browser
Species Human (GRCh38)
Location 1:32968093-32968115
Sequence CAGAATCCCAGCTTGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904783512_904783518 28 Left 904783512 1:32968042-32968064 CCCAGATGCCTTTTAGATGCTTC No data
Right 904783518 1:32968093-32968115 CAGAATCCCAGCTTGCTGGAAGG No data
904783513_904783518 27 Left 904783513 1:32968043-32968065 CCAGATGCCTTTTAGATGCTTCT No data
Right 904783518 1:32968093-32968115 CAGAATCCCAGCTTGCTGGAAGG No data
904783515_904783518 4 Left 904783515 1:32968066-32968088 CCTTGTGCAGCTGACAGAAACGG No data
Right 904783518 1:32968093-32968115 CAGAATCCCAGCTTGCTGGAAGG No data
904783514_904783518 20 Left 904783514 1:32968050-32968072 CCTTTTAGATGCTTCTCCTTGTG No data
Right 904783518 1:32968093-32968115 CAGAATCCCAGCTTGCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904783518 Original CRISPR CAGAATCCCAGCTTGCTGGA AGG Intergenic
No off target data available for this crispr