ID: 904783902

View in Genome Browser
Species Human (GRCh38)
Location 1:32971252-32971274
Sequence CCTCGCTTCTTGGCAAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904783898_904783902 -8 Left 904783898 1:32971237-32971259 CCCAGGATTGTTAAGCCTCGCTT No data
Right 904783902 1:32971252-32971274 CCTCGCTTCTTGGCAAATGCTGG No data
904783895_904783902 28 Left 904783895 1:32971201-32971223 CCATTTGGCCTTCTTTATGTTAT No data
Right 904783902 1:32971252-32971274 CCTCGCTTCTTGGCAAATGCTGG No data
904783899_904783902 -9 Left 904783899 1:32971238-32971260 CCAGGATTGTTAAGCCTCGCTTC No data
Right 904783902 1:32971252-32971274 CCTCGCTTCTTGGCAAATGCTGG No data
904783896_904783902 20 Left 904783896 1:32971209-32971231 CCTTCTTTATGTTATCTAACTAA No data
Right 904783902 1:32971252-32971274 CCTCGCTTCTTGGCAAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904783902 Original CRISPR CCTCGCTTCTTGGCAAATGC TGG Intergenic
No off target data available for this crispr