ID: 904786690

View in Genome Browser
Species Human (GRCh38)
Location 1:32988214-32988236
Sequence TTGTATACATAGCTGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904786690_904786692 14 Left 904786690 1:32988214-32988236 CCAGGCTCCAGCTATGTATACAA No data
Right 904786692 1:32988251-32988273 TTGTTTTTGTTTTTTGAGACAGG 0: 181
1: 566
2: 16722
3: 24611
4: 39755
904786690_904786695 28 Left 904786690 1:32988214-32988236 CCAGGCTCCAGCTATGTATACAA No data
Right 904786695 1:32988265-32988287 TGAGACAGGGTTGCCCAGGCTGG 0: 8
1: 53
2: 221
3: 457
4: 1361
904786690_904786693 15 Left 904786690 1:32988214-32988236 CCAGGCTCCAGCTATGTATACAA No data
Right 904786693 1:32988252-32988274 TGTTTTTGTTTTTTGAGACAGGG 0: 209
1: 648
2: 17725
3: 26544
4: 46728
904786690_904786694 24 Left 904786690 1:32988214-32988236 CCAGGCTCCAGCTATGTATACAA No data
Right 904786694 1:32988261-32988283 TTTTTGAGACAGGGTTGCCCAGG 0: 12
1: 47
2: 169
3: 414
4: 878

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904786690 Original CRISPR TTGTATACATAGCTGGAGCC TGG (reversed) Intergenic
No off target data available for this crispr