ID: 904786692

View in Genome Browser
Species Human (GRCh38)
Location 1:32988251-32988273
Sequence TTGTTTTTGTTTTTTGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81835
Summary {0: 181, 1: 566, 2: 16722, 3: 24611, 4: 39755}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904786690_904786692 14 Left 904786690 1:32988214-32988236 CCAGGCTCCAGCTATGTATACAA No data
Right 904786692 1:32988251-32988273 TTGTTTTTGTTTTTTGAGACAGG 0: 181
1: 566
2: 16722
3: 24611
4: 39755
904786689_904786692 15 Left 904786689 1:32988213-32988235 CCCAGGCTCCAGCTATGTATACA No data
Right 904786692 1:32988251-32988273 TTGTTTTTGTTTTTTGAGACAGG 0: 181
1: 566
2: 16722
3: 24611
4: 39755
904786691_904786692 7 Left 904786691 1:32988221-32988243 CCAGCTATGTATACAATATAGAG No data
Right 904786692 1:32988251-32988273 TTGTTTTTGTTTTTTGAGACAGG 0: 181
1: 566
2: 16722
3: 24611
4: 39755

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904786692 Original CRISPR TTGTTTTTGTTTTTTGAGAC AGG Intergenic
Too many off-targets to display for this crispr