ID: 904792057

View in Genome Browser
Species Human (GRCh38)
Location 1:33030091-33030113
Sequence GTGGTGCAGGACGTAAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 77}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904792057_904792061 18 Left 904792057 1:33030091-33030113 CCTGTGTTTACGTCCTGCACCAC 0: 1
1: 0
2: 0
3: 3
4: 77
Right 904792061 1:33030132-33030154 ACGCATGGTTCCCAAATACGCGG 0: 1
1: 0
2: 0
3: 2
4: 15
904792057_904792060 3 Left 904792057 1:33030091-33030113 CCTGTGTTTACGTCCTGCACCAC 0: 1
1: 0
2: 0
3: 3
4: 77
Right 904792060 1:33030117-33030139 AGACAAACTGCTCTTACGCATGG 0: 1
1: 0
2: 0
3: 3
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904792057 Original CRISPR GTGGTGCAGGACGTAAACAC AGG (reversed) Intronic
902528045 1:17071925-17071947 GTGGTACAGGAGGAAAACGCAGG - Intronic
902630046 1:17699360-17699382 GTGGTGCTGGACTTGATCACAGG - Intergenic
902989979 1:20180530-20180552 GTGGGCCAGGACTTAAACTCTGG + Intergenic
904468350 1:30721037-30721059 GTGGAGCAGGGCGTGAACCCAGG + Intronic
904792057 1:33030091-33030113 GTGGTGCAGGACGTAAACACAGG - Intronic
914904450 1:151732388-151732410 GTGGATCAGGATGTAAACTCTGG - Intergenic
923305246 1:232682398-232682420 GTGCTGTAGGTGGTAAACACAGG + Intergenic
1062915017 10:1238054-1238076 GGGATGCAGGGAGTAAACACCGG - Intronic
1062915055 10:1238171-1238193 GGGATGCAGGGAGTAAACACCGG - Intronic
1062915114 10:1238360-1238382 GGGATGCAGGGAGTAAACACCGG - Intronic
1062915220 10:1238694-1238716 GGGATGCAGGGAGTAAACACCGG - Intronic
1062915279 10:1238883-1238905 GGGATGCAGGGAGTAAACACCGG - Intronic
1065398043 10:25262660-25262682 GTGGTGCAGAATGTAGACAGTGG - Intronic
1067220054 10:44337404-44337426 ATGGTGCAGGATGTGATCACTGG + Intergenic
1069288654 10:66748786-66748808 GTGGTGCAGGATATAGACAGAGG - Intronic
1076815566 10:132913138-132913160 GTGGTTCAGGACGTAGACCACGG + Exonic
1080306021 11:30837265-30837287 GGGGTGCAGGACATTAACAGTGG + Intronic
1082057878 11:47834867-47834889 TTGGTGCAGGATGGAAACTCAGG + Intronic
1083946533 11:65926386-65926408 GTGGGTCTGGACTTAAACACAGG + Intergenic
1089984897 11:122803739-122803761 GTGGTCCAGGTTGTAAGCACAGG - Intronic
1090008011 11:123019509-123019531 GTGGTTTAGGAGGTAAACAGAGG - Intergenic
1095079085 12:37974944-37974966 GTGGAGCAGTTCGTAAGCACTGG + Intergenic
1103534863 12:121627196-121627218 GAGGTGCTGGACGTGAGCACTGG + Intronic
1103646115 12:122394165-122394187 GTAATGCAGTACGTAAACAATGG - Intronic
1103960047 12:124603799-124603821 CTGGTGCAGAATGGAAACACAGG - Intergenic
1106501644 13:30334961-30334983 GAGACACAGGACGTAAACACGGG + Intergenic
1110672830 13:78202214-78202236 GTTGTGCAGCACAGAAACACTGG - Intergenic
1111399081 13:87708593-87708615 GGGGTGAAGGAGGTAAAAACTGG + Intergenic
1117753498 14:58948243-58948265 TAGGTGCAGAACGTAACCACAGG - Intergenic
1131928208 15:97409935-97409957 GTGGAACAGCACCTAAACACTGG - Intergenic
1133902155 16:9986963-9986985 GTGGTGCTGGAAGGAAACTCGGG - Intronic
1139232911 16:65303690-65303712 GTGGTGCAGGATGTCAATAGTGG + Intergenic
1141695050 16:85615133-85615155 GTGGAGGCGGCCGTAAACACAGG - Intronic
1143187960 17:5021964-5021986 GTGGAGCAGGACTTGAACCCAGG + Intronic
1148777304 17:50102787-50102809 GTGGGGCAGGAGGGAAGCACAGG + Intronic
1160263319 18:77316130-77316152 GTGGTGCATGAAGAAAACCCTGG - Intergenic
1160405711 18:78645137-78645159 GGGGTGCAGGATGGAAACCCTGG - Intergenic
1161335145 19:3708912-3708934 GGGCTGCAGGAGGTAAACCCAGG - Intronic
1167069230 19:47210089-47210111 GTGGTTTAGGAGGTAAACAAAGG - Exonic
927574161 2:24187385-24187407 GTGGTGCAGGATGTCAACAGTGG - Intronic
929693266 2:44092155-44092177 GTGTTGCAGGACATAACAACTGG + Intergenic
935621517 2:105134436-105134458 GTTGTGCAGGACTGAAAAACGGG + Intergenic
939221234 2:139303863-139303885 CTGGTGCAGGAAGTAATGACTGG + Intergenic
942421759 2:175815100-175815122 GTGGTGCAGGATGTTAACTCGGG - Intergenic
945129920 2:206559913-206559935 CAGGTGCAGGAGGAAAACACTGG - Intronic
947506517 2:230712391-230712413 GTGGAGCAGGACTTAAATCCAGG + Intergenic
1170007594 20:11686253-11686275 GGGTTGGAGGATGTAAACACAGG - Intergenic
1171487348 20:25494390-25494412 GTGGTGCAGTACGTGTACATGGG - Intronic
1172625894 20:36346531-36346553 GTGGTGCAGGCAGGAAAAACAGG + Intronic
1174160328 20:48545807-48545829 GTGAAGCAGGCTGTAAACACAGG - Intergenic
1175736704 20:61392136-61392158 GTGCTGCAGGAGGTGAACCCGGG + Intronic
1175756836 20:61535590-61535612 CTGGTGCAGGATGAAAACGCGGG + Intronic
951630563 3:24715599-24715621 GTGATGCAAGATGTTAACACTGG - Intergenic
958097414 3:88964256-88964278 TAGGTGCAGGACTTAATCACAGG - Intergenic
967835725 3:193960778-193960800 GTGGTGCAGGAGGAGAACAAGGG + Intergenic
969228520 4:5814404-5814426 GTGGTGCAGAACGTGACCCCTGG - Intronic
976076350 4:81303490-81303512 GTGGAGCAGGAGGTTCACACAGG - Intergenic
981413660 4:144462603-144462625 TTGGTGCAGGACGAAAACTGAGG + Intergenic
981666788 4:147237018-147237040 GTGGTGGAGGAGGGAAACAAAGG - Intergenic
981898542 4:149834433-149834455 GTGGTTAAGAACATAAACACTGG + Intergenic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
984981319 4:185284667-185284689 GAGGTGCAGGAGGTAAACAAGGG + Intronic
986056861 5:4146725-4146747 GTGAGGCTGGACGTAAACTCTGG - Intergenic
995491837 5:112701650-112701672 GAGGAGAAGGAAGTAAACACTGG + Intergenic
1001024686 5:168214169-168214191 GTGGCTCAGGACTAAAACACAGG - Intronic
1015945511 6:138496253-138496275 GCGGTGCAGGTCCTCAACACAGG + Exonic
1019609275 7:1928749-1928771 TGGGGGCATGACGTAAACACAGG + Intronic
1020208519 7:6139548-6139570 GGGGTTCAGGAAATAAACACAGG - Intronic
1030522660 7:110617642-110617664 GTGGTACAGGAGGTAATCAGTGG + Intergenic
1035561073 8:603886-603908 GTGTTGCAGGACATCAGCACTGG - Intergenic
1035764375 8:2093974-2093996 GTGGTGCACGGCTTAACCACGGG + Exonic
1038338252 8:26662548-26662570 GTGGTGCAGGATGTCAAAAGTGG - Intergenic
1047170344 8:122486515-122486537 GAGGTGAAGGACGTTAAGACTGG + Intergenic
1056276644 9:85000180-85000202 CTGGTGCAGGATGTTAACAGTGG - Intronic
1057025150 9:91729521-91729543 GAAGTGCAGGAAATAAACACTGG - Intronic
1058213741 9:102205748-102205770 GTGGCGCTGGACATAAGCACAGG - Intergenic
1058296633 9:103315790-103315812 GTGGTGCAGGATGTCAATAGTGG + Intergenic
1062564949 9:137160140-137160162 GCGGTGGAGCACGTACACACGGG + Intronic
1186321689 X:8433885-8433907 GTGCTGCAGGAAGTATGCACAGG + Intergenic
1188199032 X:27277116-27277138 GTGCTGAAGGAGGTGAACACGGG + Intergenic
1199698377 X:150359797-150359819 GTGGTTCATGACCTAAACAAAGG - Intergenic