ID: 904794567

View in Genome Browser
Species Human (GRCh38)
Location 1:33049629-33049651
Sequence AGTCGCCAGCTTCCAAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904794565_904794567 -9 Left 904794565 1:33049615-33049637 CCGATTTCCATAAAAGTCGCCAG 0: 1
1: 0
2: 0
3: 5
4: 74
Right 904794567 1:33049629-33049651 AGTCGCCAGCTTCCAAGAAAAGG 0: 1
1: 0
2: 0
3: 6
4: 80
904794563_904794567 29 Left 904794563 1:33049577-33049599 CCTTTCTACTACTGTTTTGAGGT 0: 1
1: 0
2: 1
3: 10
4: 177
Right 904794567 1:33049629-33049651 AGTCGCCAGCTTCCAAGAAAAGG 0: 1
1: 0
2: 0
3: 6
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904794567 Original CRISPR AGTCGCCAGCTTCCAAGAAA AGG Intronic
902522465 1:17027941-17027963 AGTAGTCAGTGTCCAAGAAATGG - Intronic
904794567 1:33049629-33049651 AGTCGCCAGCTTCCAAGAAAAGG + Intronic
906240282 1:44238497-44238519 AGGTGCCAGGTTCCAAGCAAAGG + Intronic
907921690 1:58919842-58919864 AGCTTCCAGGTTCCAAGAAAAGG + Intergenic
910350592 1:86292815-86292837 AGTCAAAAGCTTCAAAGAAAAGG - Intergenic
913074500 1:115330422-115330444 AGTCGCCATCTAACAATAAATGG + Intronic
913207775 1:116556971-116556993 AGTTGCCAACTTTCAAGAACAGG - Intronic
913690841 1:121278357-121278379 AGTAGTCAGTTTCCAAGAAAAGG - Intronic
914146698 1:145001606-145001628 AGTAGTCAGTTTCCAAGAAAAGG + Intronic
915770586 1:158418509-158418531 AGTTTCAAGCTTCAAAGAAATGG + Intergenic
920478161 1:206296842-206296864 GGTAGTCAGTTTCCAAGAAAAGG - Intronic
1071991510 10:91104640-91104662 AGCCCCCAGTTTCCTAGAAATGG - Intergenic
1071991610 10:91105331-91105353 AGCCCCCAGTTTCCCAGAAATGG + Intergenic
1074938029 10:118205810-118205832 TCTGGCCAGCTTCTAAGAAAGGG + Intergenic
1077461840 11:2714696-2714718 TGTAGCCAGCATCCCAGAAAGGG + Intronic
1078871871 11:15354578-15354600 AGCACCCAGCTTCTAAGAAAAGG + Intergenic
1080580940 11:33643223-33643245 AGTCTCCACCTTCCCAGCAAAGG + Intronic
1080989289 11:37510635-37510657 AGTTGCTAGATTCCTAGAAAGGG + Intergenic
1094160763 12:27387800-27387822 AGTAGCTAGTTTCCATGAAATGG - Intronic
1102099852 12:110269971-110269993 AGACTCCAGCTTGCAAGACACGG + Intergenic
1102779698 12:115553423-115553445 AGCCACCAGCTTCCAAAACAAGG + Intergenic
1104140575 12:125983359-125983381 AGTCGCCAGGCTCCACGAAGCGG + Intergenic
1114246820 14:20921940-20921962 TGTCCACAGCTTGCAAGAAAGGG - Intergenic
1115055440 14:29120977-29120999 AGATGCCAGCTACAAAGAAATGG + Intergenic
1115491775 14:33965001-33965023 ACCCTCCAGCTTCCAGGAAAGGG - Intronic
1122473261 14:101986742-101986764 TGTCTTCAACTTCCAAGAAAAGG + Exonic
1128956187 15:71948114-71948136 AGTGACTTGCTTCCAAGAAATGG - Intronic
1133529231 16:6639089-6639111 AGCTGCCAGTTTGCAAGAAATGG - Intronic
1142590971 17:1005942-1005964 GGAAGCCAGCTTCCAAGAACTGG - Exonic
1144070616 17:11668338-11668360 AATCAGCTGCTTCCAAGAAATGG + Intronic
1150587995 17:66535635-66535657 TGACACCAGCTGCCAAGAAAAGG - Intronic
1151869479 17:76826771-76826793 ATTCACCAGCTTCCAGGAGATGG + Intergenic
1155522679 18:26685057-26685079 ATTCACCAGCTTCCATGGAATGG - Intergenic
1159437728 18:68440421-68440443 AGTCTCTAACTTCCCAGAAAAGG + Intergenic
926726287 2:16000812-16000834 GGCTGCCAGCTCCCAAGAAAAGG - Intergenic
930946869 2:57085176-57085198 AGTCGGCTGCCTCCAAGATACGG + Intergenic
934919312 2:98330115-98330137 AGTCACCATCTTCCAAGGGAGGG + Intergenic
935293796 2:101630903-101630925 ACTCGCCAGCTTCAGATAAATGG + Intergenic
937433499 2:121860841-121860863 AGACCCCAGCGTCCATGAAAAGG + Intergenic
939491029 2:142876612-142876634 ACTCTCCAGTTTCCAAGAGAGGG - Intergenic
946948922 2:224851044-224851066 ATACGCCAGCTTCCAGGATAGGG + Intronic
948310642 2:236983234-236983256 GGTGGCCAGGTTCCAAGAAGGGG + Intergenic
948688002 2:239683196-239683218 AATCCCCATCTTCCAAAAAAAGG - Intergenic
1169603455 20:7289099-7289121 AGTCACCATCTTCCAAGCATTGG + Intergenic
1171978533 20:31610757-31610779 AGGCGCCACTTTCCAGGAAAGGG + Intergenic
1174225486 20:48995817-48995839 GATGGCCAGCTTCCAAGAATCGG + Exonic
1174294848 20:49538535-49538557 ATTCTTCAGCTTCCTAGAAATGG - Intronic
1175194947 20:57236645-57236667 AGTGGCCAGATTCAGAGAAAGGG + Intronic
1177893983 21:26840036-26840058 ATTCCCCAGCTTCCATGAAAAGG + Exonic
1181886008 22:26022968-26022990 AGTAGCCAGCTGCCCAGAAATGG - Intronic
1182175079 22:28277111-28277133 AATCTCTATCTTCCAAGAAAGGG + Intronic
951970289 3:28436926-28436948 AATCTCCATCTTCAAAGAAAAGG - Intronic
953273061 3:41465027-41465049 AGTCACCAGCTCCCAAGGGAAGG + Intronic
954117516 3:48475433-48475455 ACTCGGCGGCCTCCAAGAAATGG + Intronic
960324821 3:116283004-116283026 GGTGGCCAGCTGCCAAGGAAGGG - Intronic
960797060 3:121498584-121498606 AGTTGCCAACTTCAATGAAAAGG - Exonic
964379810 3:156086912-156086934 AGTGGGCAGCTTCTAGGAAAAGG + Intronic
964538692 3:157755549-157755571 AGTTGATAGCTTCCAAGACAGGG + Intergenic
965237813 3:166149253-166149275 AGCCATCAGCTTCCAATAAAAGG + Intergenic
978885570 4:113762377-113762399 CGTCGCCAGCTCCCCAGAACCGG + Intergenic
979473241 4:121125555-121125577 AGTCGCAAGGTTGCAAGACAGGG + Intergenic
981236875 4:142427609-142427631 GGTGGCCAGCCTTCAAGAAATGG - Intronic
988012267 5:25504702-25504724 AGTTGACAGCATCCAAGAACAGG - Intergenic
990383639 5:55238507-55238529 TGTCCACTGCTTCCAAGAAAAGG + Intergenic
992203108 5:74403419-74403441 GGACTCCAGCTTCCAAGAATAGG + Intergenic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
1001513715 5:172340398-172340420 AGCCGACAGCTTCCCAGAAGGGG - Intronic
1005511322 6:26514230-26514252 TGCCAACAGCTTCCAAGAAAAGG + Intergenic
1007155941 6:39743785-39743807 AATCTCCTGCTTCCAGGAAAAGG - Intergenic
1008606545 6:53145617-53145639 AGTCGTCAGGTTCCATGATAAGG + Exonic
1016575102 6:145561381-145561403 AGTCCCGAGCTACCTAGAAATGG - Intronic
1024673868 7:51620844-51620866 AGTCACCAGCTTCCTTGGAAAGG + Intergenic
1033034316 7:137859036-137859058 AGTCGTCAGATTCTTAGAAATGG + Intergenic
1033449752 7:141451869-141451891 AGAAGCCAGCTTCCGAGACAGGG - Intronic
1042043535 8:64621996-64622018 ACTGGCCAGCTTCCAGGCAAAGG + Intronic
1042784573 8:72534354-72534376 AGTACCCTGCTTCCCAGAAATGG + Intergenic
1045574296 8:103402851-103402873 AGACCACAGCTTCCAAGGAATGG + Intronic
1048354265 8:133640674-133640696 AGTCTCCAGCCTCAAAGAAGAGG - Intergenic
1056685168 9:88753065-88753087 AGTCACCAACATCCAAGAAAAGG + Intergenic
1061207629 9:129173965-129173987 AGTGCCCAGCTCCCAACAAAGGG + Intergenic
1061488635 9:130933395-130933417 AGCCCCCAGCTCCCAAGACAGGG + Intronic
1203443263 Un_GL000219v1:31150-31172 AGTCGCCAGTTTCAATGAAGGGG + Intergenic
1203514071 Un_KI270741v1:150059-150081 AGTCGCCAGTTTCAATGAAGGGG + Intergenic
1186306388 X:8264137-8264159 AGTTGCCAGCTTACAAGGCAAGG - Intergenic
1197699153 X:129584346-129584368 AGAAGACAGCTTCCTAGAAAAGG + Exonic
1198118679 X:133569442-133569464 TGTCCCCAGCTTCCAGGAACTGG - Intronic
1198957470 X:142148536-142148558 AGACTCCAGCATCCAAGAAGAGG - Intergenic