ID: 904795873

View in Genome Browser
Species Human (GRCh38)
Location 1:33055991-33056013
Sequence TGGTCTCTGCTTACGGTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 58}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904795873 Original CRISPR TGGTCTCTGCTTACGGTAGG TGG Intronic
901828055 1:11875336-11875358 TGGACTCTGCTTCCGATGGGAGG - Intergenic
904795873 1:33055991-33056013 TGGTCTCTGCTTACGGTAGGTGG + Intronic
906289929 1:44613243-44613265 TGGCCTCTGCTTACAGGAGTGGG - Intronic
910218828 1:84868744-84868766 TGGTCTCTGCTTCCAGAAGGGGG - Intronic
910328001 1:86032157-86032179 GGGACTCTGCTTAAGCTAGGTGG - Intronic
919371618 1:196734555-196734577 TGGTCTCTGTTTACTTTAGGGGG + Intronic
920988666 1:210914914-210914936 TTCTCTCTGCTAATGGTAGGGGG - Intronic
923935000 1:238749533-238749555 TTGTCTCTGGTTAGGGAAGGAGG - Intergenic
1065218070 10:23469839-23469861 AGGTCTCTGCTTTCAGTAGCAGG + Intergenic
1066189111 10:33039223-33039245 TGGTTTCTGCATAGAGTAGGAGG + Intergenic
1083019565 11:59493061-59493083 TGCTCTCAGCTATCGGTAGGTGG - Intergenic
1083064654 11:59912419-59912441 TGGTGTGTGCTTGCTGTAGGAGG + Intergenic
1101778840 12:107817574-107817596 TGGTGACTGCTTTCGGTTGGGGG - Intergenic
1108174265 13:47776350-47776372 TGGTCTCAGCTTGGGGTAGCTGG - Intergenic
1108795762 13:54028373-54028395 TGGTGTCTGCATACTGCAGGTGG + Intergenic
1110961813 13:81636259-81636281 TGGTCTCTGCTTTAGGCAGGTGG + Intergenic
1113438803 13:110312696-110312718 TGATCACTGCTGAAGGTAGGAGG + Intronic
1118400212 14:65372862-65372884 TGGTCTCTCTTTCCGGTTGGAGG + Intergenic
1122771206 14:104098708-104098730 AGGTCTCTGCCTGCGGTGGGTGG + Intronic
1124156340 15:27228218-27228240 TGGGGTCTGCTTAAGGCAGGAGG - Intronic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1131328145 15:91468966-91468988 TGGTGTCTACTTGCAGTAGGAGG + Intergenic
1151942206 17:77299930-77299952 TGGCCTCTGTTTGGGGTAGGAGG - Intronic
1155176650 18:23307061-23307083 TGGACTCTGTTCACTGTAGGAGG - Intronic
1160532686 18:79574856-79574878 TGCTCTCTGCTTATGGCAGCAGG - Intergenic
1162953180 19:14083869-14083891 TGGTCTCTGCTGAAGGAAGAAGG + Exonic
927641561 2:24848886-24848908 TGAGCTCTGCTTACTGCAGGTGG + Intronic
927751190 2:25672770-25672792 GGGTCTCTACCTACGGTAGCTGG + Intronic
937207585 2:120246370-120246392 TAGTCACTGCTTACTGTTGGAGG - Intronic
937717291 2:125047547-125047569 TGGTCTCTGGGTATGGAAGGTGG - Intergenic
942414568 2:175745402-175745424 TGGGCTCTGCTCAAGCTAGGTGG + Intergenic
948059500 2:235032684-235032706 TGGTCACTGCTTCTGGTAGGGGG + Intronic
1171194860 20:23189163-23189185 TGGTTTCTGCCTATGGGAGGAGG + Intergenic
1172835730 20:37871917-37871939 TGTTCTCTGCATACTCTAGGGGG - Exonic
1176022038 20:62966906-62966928 TGGACTTTGCTGACGGCAGGTGG + Intronic
1176217668 20:63955981-63956003 TGGTCTCTGCCCCCGGTGGGTGG - Intronic
1181814385 22:25427139-25427161 TGGCTTCTGCTTCCAGTAGGGGG + Intergenic
1182374207 22:29834527-29834549 TGGTCTCTGCATACACGAGGTGG + Exonic
1182521886 22:30889448-30889470 TGGCCTCTGCTGACGGTGAGGGG + Intronic
951106415 3:18748725-18748747 TGGCCTCTGCTTTTGGTGGGTGG + Intergenic
951866592 3:27315546-27315568 TGATCTCTATTTATGGTAGGAGG + Intronic
956557559 3:70540001-70540023 TTGTCTCTGGTTAGGGAAGGAGG + Intergenic
960215907 3:115036908-115036930 TGCTCTCTGCTAATGCTAGGGGG - Intronic
965615533 3:170588245-170588267 TGGAATCTGCTTAAGGTTGGAGG - Intronic
965934413 3:174089408-174089430 TGGTCTCTGCTTCAGGTTTGAGG + Intronic
966912731 3:184568615-184568637 TGGTCCCTGCCTTCGGCAGGAGG - Intronic
968044949 3:195618770-195618792 TGGTCTCTGCTTCTGGAATGGGG - Intergenic
968060733 3:195724822-195724844 TGGTCTCTGCTTCTGGAATGGGG - Exonic
972774045 4:42225158-42225180 TGGTCTCTGCTTCCTGGAGGAGG + Intergenic
985945099 5:3175923-3175945 TGGTCACTGCTTACATGAGGTGG - Intergenic
989821208 5:45797246-45797268 TTGTCTCTGCTTAGGGAAGGAGG - Intergenic
992937028 5:81718480-81718502 TGACCTCTGCTTCCGGTAGGAGG - Intronic
998636609 5:143962028-143962050 TGGTCTCTGCCTATAGTAGGAGG - Intergenic
1010895173 6:81353114-81353136 TTTTCTCTGCTTACTATAGGAGG - Intergenic
1012496836 6:99843056-99843078 TGAATTCAGCTTACGGTAGGAGG - Intergenic
1032400611 7:131621900-131621922 TGGTCTCTGCTTTGGGAGGGAGG + Intergenic
1032739057 7:134720804-134720826 TGTTGTCTGCTTTCAGTAGGAGG + Intergenic
1033335569 7:140449390-140449412 TGGTGACTGCTTTCGATAGGGGG - Intergenic
1034856185 7:154549637-154549659 CAGTCTCTGCTTACGTTAGAAGG + Intronic
1039704141 8:39989881-39989903 TGGGCTCTGCTTAGGGGAAGAGG + Intronic
1041401140 8:57446643-57446665 TGGTCTCTGCTTCCAGAGGGAGG - Intergenic
1046615215 8:116469806-116469828 TGGTCTCTGCATACTGGGGGAGG - Intergenic
1057149794 9:92786157-92786179 TGGTCTCTGCCTACAAAAGGCGG + Intergenic
1057480884 9:95444817-95444839 TGGTCTCTGGTTACGAGATGAGG + Exonic
1189317095 X:40064053-40064075 TGGTCTCTGCTTTTGGGAAGGGG + Intronic
1190376461 X:49793292-49793314 TGGTCTGTGCTTAGGGTGTGAGG + Intergenic
1198631708 X:138646364-138646386 TGGAATCTGTTTACGGTAGCTGG + Intronic