ID: 904802459

View in Genome Browser
Species Human (GRCh38)
Location 1:33103513-33103535
Sequence GAGGTGAGCCTACTTTAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904802459 Original CRISPR GAGGTGAGCCTACTTTAGAG AGG (reversed) Intronic
902632961 1:17716638-17716660 GAGGGAAGCCTACTTCAGATGGG - Intergenic
904802459 1:33103513-33103535 GAGGTGAGCCTACTTTAGAGAGG - Intronic
908331603 1:63076227-63076249 GAGGCGATCATACTTTAAAGAGG - Intergenic
917517606 1:175721175-175721197 GAGGTGGGGCTGCTTTAGTGAGG - Intronic
923287874 1:232514384-232514406 GAGGAGAGCCGACTGGAGAGGGG - Exonic
1063145723 10:3293695-3293717 GAGGGGAGTCTAATTTAGAGTGG + Intergenic
1068200657 10:53780296-53780318 AAGGACAGCCTACTTTACAGAGG - Intergenic
1072832271 10:98671269-98671291 GAGGTGACCCCATTTTACAGTGG - Intronic
1075180714 10:120208244-120208266 CAGGTGGACCTACTTTAGATGGG - Intergenic
1084343607 11:68527291-68527313 GGGGTGAGCCTAATGAAGAGGGG - Intronic
1084610534 11:70199738-70199760 GAGGGCAGCCTTCTTTAGATTGG - Intergenic
1086947438 11:92857050-92857072 CAGGTGTGCCTACTTCTGAGTGG + Intronic
1094082788 12:26555764-26555786 GAGGTCAGCCTGATTCAGAGAGG - Intronic
1100233382 12:92632830-92632852 GAGGTGAAAATAATTTAGAGAGG - Intergenic
1100652541 12:96606149-96606171 GAGCTGAGCCTATTTTAGACGGG + Intronic
1101485538 12:105154797-105154819 TAGGAGAGCCTAGTATAGAGCGG - Intronic
1104737728 12:131148367-131148389 GTGGGGGGCCTACTTGAGAGTGG - Intergenic
1105347504 13:19587539-19587561 GAGGAAAGGCTAATTTAGAGCGG - Intergenic
1109765930 13:66897356-66897378 AAGTTGAGACTTCTTTAGAGGGG - Intronic
1115005103 14:28472904-28472926 GATTGGAGCCTACTTGAGAGTGG - Intergenic
1117269445 14:54127058-54127080 GAGAGGAGGCTAATTTAGAGTGG + Intergenic
1117753283 14:58945879-58945901 GATGAGAGCCTGATTTAGAGTGG - Intergenic
1118118149 14:62804786-62804808 GAGTTGAGCCTAGTTTAGCCTGG + Intronic
1120218266 14:81704226-81704248 GGGATGGGCCTACTTTAGATTGG - Intergenic
1120307425 14:82788593-82788615 GAGGTCATCCTAGGTTAGAGTGG + Intergenic
1133662537 16:7933206-7933228 GAGCAGAGCCTCCTTTAGTGGGG - Intergenic
1134435327 16:14251410-14251432 TAGATGAGCCCACCTTAGAGAGG + Intronic
1138130835 16:54478615-54478637 GAGGTGGCTCTTCTTTAGAGTGG + Intergenic
1143528466 17:7485858-7485880 GAGGTGGGGCTACTTTAGATGGG + Intronic
1147627119 17:41907422-41907444 GAGGTAAGGCTGGTTTAGAGAGG - Exonic
1155616541 18:27728081-27728103 GAGATGTGTCTACTTGAGAGTGG - Intergenic
1156854385 18:41765118-41765140 GAGGTGTGCCCACCTGAGAGTGG - Intergenic
1157083102 18:44549554-44549576 AAGATGAACCTACTTGAGAGAGG - Intergenic
1157872286 18:51241653-51241675 GAGTTGAGCTTCCTATAGAGTGG + Intergenic
1165216420 19:34276969-34276991 GAGGTGACCCTAGATTAGACAGG + Intronic
1166857660 19:45791315-45791337 GAGGTGACCCAACTTTGGGGAGG - Intronic
931400181 2:61924546-61924568 GAGGTGAGTCTGGTTTGGAGCGG + Intronic
931786930 2:65628288-65628310 GGAGTGAGCCAACTTGAGAGTGG + Intergenic
943132176 2:183867623-183867645 GAGGTGAGCCTAGTTGAGCATGG + Intergenic
945092279 2:206186600-206186622 GAGGGGAGCTTCCCTTAGAGGGG + Intronic
945479364 2:210326260-210326282 GAGTGGAACCTACTTTAGATAGG - Intergenic
948091592 2:235300613-235300635 CAGGTGGGCATAATTTAGAGGGG - Intergenic
1171194406 20:23186311-23186333 GAGGTGAGGTTAGTTTAAAGTGG + Intergenic
1180652026 22:17385804-17385826 GAGGTGGGCCTGTATTAGAGCGG + Intronic
1182940781 22:34275020-34275042 GAGTGGAGCCTGTTTTAGAGTGG + Intergenic
1183075362 22:35423339-35423361 CAGGTGAGCCTGCCTTGGAGTGG + Exonic
1184177066 22:42794485-42794507 GAGGGGAGGCTACATTGGAGAGG - Intergenic
1184391290 22:44204997-44205019 GTGGTGAGCCCACTTTGCAGGGG + Intronic
950280051 3:11699312-11699334 GAGCTCAGCATACTTGAGAGTGG + Intronic
950349997 3:12340437-12340459 GAGAGGTGCTTACTTTAGAGTGG + Intronic
950415612 3:12867466-12867488 GAGGTGACCCTACTGCAGATGGG - Intronic
951607328 3:24450716-24450738 AAGCTGAGCCTACTATAGATTGG - Intronic
951906003 3:27708167-27708189 GAGGTCAGCCTCCTCTATAGAGG - Intergenic
952982490 3:38748931-38748953 GGGGTGATGCTACTTTATAGTGG - Intronic
953793458 3:45965852-45965874 GATGTGTGCCTCCTTTAAAGTGG + Intronic
954293198 3:49660544-49660566 AAGGTGAGCCTCCTCTGGAGGGG - Exonic
954452919 3:50581336-50581358 GATGTGAGCCTACATCAGGGTGG + Exonic
954571614 3:51645732-51645754 GAGGTGAGGGTACTTCAGACAGG - Exonic
954581118 3:51703444-51703466 GAGCTGAGGCTAATTTAGAGTGG + Intronic
956701667 3:71964531-71964553 AAGGTGAGCCTACTTTCAATGGG - Intergenic
961783981 3:129338396-129338418 GAGGTGACCCTACTGCAGATGGG - Intergenic
962748990 3:138418954-138418976 GAGGTGATCCTGTTATAGAGAGG + Intergenic
964439620 3:156693705-156693727 GAGGCCAGCCCACTGTAGAGTGG + Intronic
969700455 4:8764892-8764914 GAGGTGGGCCTGCCTTAGATGGG + Intergenic
970660058 4:18275299-18275321 AAGGTGAGCCTAGTCTAGGGTGG + Intergenic
990253516 5:53941829-53941851 GAGGTGAGCACCCTGTAGAGAGG - Intronic
993039373 5:82794845-82794867 AAGGTGAGCCTACTGTAGCCTGG - Intergenic
998187557 5:139993534-139993556 GATGTGAGACTATTTTAGATTGG - Intronic
1001384823 5:171330061-171330083 GAGAAGAGCATACTTCAGAGAGG - Intergenic
1004347197 6:14859438-14859460 GAGGTGAGCAGACATAAGAGAGG - Intergenic
1013630195 6:111979223-111979245 GAGGTTAGCCAAATTTACAGAGG + Intergenic
1013936970 6:115608018-115608040 GTGGTGAGCCAACTTTTAAGGGG + Intergenic
1015493418 6:133854638-133854660 GAGGAGAGCCCACATTAGACAGG + Intergenic
1016443227 6:144106335-144106357 GAGGGGAGGCCACTCTAGAGAGG + Intergenic
1021421147 7:20445936-20445958 GAGGTCTGCCTACCATAGAGAGG + Intergenic
1023098686 7:36690397-36690419 GAGGTGAGCCCACTGGAGACAGG - Intronic
1024589138 7:50866037-50866059 GAGGTCAGCATAATTTTGAGAGG - Intergenic
1024713413 7:52044619-52044641 GTGGTGAGCCTCTGTTAGAGAGG + Intergenic
1026495709 7:70900466-70900488 GAGGTAAGTTTAGTTTAGAGTGG - Intergenic
1026842016 7:73674734-73674756 GAGCTGATTCTTCTTTAGAGGGG + Intergenic
1031633574 7:124074122-124074144 GAGGAGAGCCTAGGGTAGAGAGG - Intergenic
1032819679 7:135513130-135513152 GAGGGGAGCCTAATTTAGATTGG + Intergenic
1035159172 7:156938566-156938588 GAGGTCAGCCTCCTGGAGAGGGG - Intergenic
1036088447 8:5638473-5638495 GAGGTGACCCTAATTTGGAAAGG - Intergenic
1045889940 8:107143736-107143758 GTGGTGAGGCTACTTTCTAGTGG + Intergenic
1046622244 8:116540557-116540579 GAGGGGAGATTACTTAAGAGAGG - Intergenic
1048679889 8:136829548-136829570 GAGGTGAGAATACTTTAGGTTGG + Intergenic
1050410304 9:5357084-5357106 GAGGTGGTGCTACTTTAGATCGG - Intergenic
1052155105 9:25177637-25177659 GAGGTGTGCCAACTTCAGGGAGG - Intergenic
1052201040 9:25780521-25780543 AAGGTTAGCCTACTTTAGTTTGG - Intergenic
1057051670 9:91928481-91928503 GCGGTGAGCCCACGTCAGAGTGG - Intronic
1058095214 9:100852428-100852450 GAGGGCTGGCTACTTTAGAGAGG - Intergenic
1058828636 9:108796267-108796289 GAGGGGGGCCCACATTAGAGAGG - Intergenic
1059399128 9:114057899-114057921 GAGGTGAGACTATTTAAGAATGG + Intergenic
1187471059 X:19570147-19570169 GAGGTGTGCCTACTCTGGAATGG + Intronic
1189511644 X:41668266-41668288 AAGGTAAGCCTGCTTTAAAGAGG + Intronic
1189707691 X:43775700-43775722 GAGGTGAGCTTTCTTGAGGGAGG + Intronic
1192479744 X:71474752-71474774 GAGGCCATCCTACTTTAGATAGG + Intronic
1193554616 X:82937713-82937735 GAGGTCAGCCTTTTCTAGAGAGG + Intergenic
1195301461 X:103534024-103534046 GAGGTGTCCATACTGTAGAGTGG - Intergenic
1197800070 X:130339416-130339438 GGGGTGAGCCGAATTTAGTGAGG - Intergenic
1199022733 X:142901130-142901152 GAACTGAGCCTAATTTAAAGAGG - Intergenic