ID: 904809070

View in Genome Browser
Species Human (GRCh38)
Location 1:33151530-33151552
Sequence CTGACTTCTCAGAGGGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 261}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904809070_904809077 4 Left 904809070 1:33151530-33151552 CCCTTCCCCCTCTGAGAAGTCAG 0: 1
1: 0
2: 3
3: 25
4: 261
Right 904809077 1:33151557-33151579 TCCATCTGTCCCTCATCCCCAGG 0: 1
1: 0
2: 8
3: 46
4: 360
904809070_904809079 7 Left 904809070 1:33151530-33151552 CCCTTCCCCCTCTGAGAAGTCAG 0: 1
1: 0
2: 3
3: 25
4: 261
Right 904809079 1:33151560-33151582 ATCTGTCCCTCATCCCCAGGAGG 0: 1
1: 0
2: 2
3: 20
4: 207
904809070_904809082 14 Left 904809070 1:33151530-33151552 CCCTTCCCCCTCTGAGAAGTCAG 0: 1
1: 0
2: 3
3: 25
4: 261
Right 904809082 1:33151567-33151589 CCTCATCCCCAGGAGGTGACAGG 0: 1
1: 0
2: 2
3: 16
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904809070 Original CRISPR CTGACTTCTCAGAGGGGGAA GGG (reversed) Intronic
901195693 1:7438659-7438681 CTGTCTCCTCCGAGGGGCAAGGG + Intronic
902172868 1:14627184-14627206 AAGCCTTCTCAGAGCGGGAAGGG + Intronic
903070576 1:20725099-20725121 CTGACTCCTCAAAGGGGCACAGG - Intronic
903795902 1:25928747-25928769 CTCACTTCACAGAGTGGGATAGG - Intergenic
904809070 1:33151530-33151552 CTGACTTCTCAGAGGGGGAAGGG - Intronic
905539315 1:38747427-38747449 CTGGCTTCTCGGAGGTGGAGAGG + Intergenic
906186680 1:43867382-43867404 CTGACTTTTGGGAGGAGGAAAGG + Intronic
906719267 1:47993945-47993967 CTTTCTTCTCCGAGGGGGAGGGG - Intronic
907579241 1:55556981-55557003 CTCATTTCTCAGTGTGGGAAGGG - Intergenic
909346916 1:74600892-74600914 CTGGCTTCTCTGTGGGGGAGGGG + Intronic
910035550 1:82783467-82783489 CTGACTTCTGAGGAGGGGAGAGG + Intergenic
914923057 1:151860465-151860487 CAGAGTTCTCAGAGGAGAAAGGG - Intergenic
915849472 1:159305775-159305797 CTGACTTTTCAGGAGGGGAAAGG + Intronic
916802469 1:168227282-168227304 CTCATTTCACAGATGGGGAACGG - Intronic
916927865 1:169541928-169541950 TTCACTTCTTAGAGGGTGAAAGG + Exonic
917454508 1:175174477-175174499 CTCATTTCTCAGATGAGGAAAGG - Intronic
918084033 1:181230115-181230137 GTGGCTGCTCAGAAGGGGAAGGG + Intergenic
918264576 1:182829665-182829687 CAGTCTTCTCAGTGGAGGAAGGG - Exonic
919814084 1:201426750-201426772 CTGAGTTCTGAGAGGGGGCAGGG + Intronic
920337027 1:205251704-205251726 CTGACTTCTCAGGGGCTCAATGG + Intronic
922743825 1:228031905-228031927 CTTCCTTCTCAGAGGGGGAGTGG - Intronic
923079991 1:230644074-230644096 CTGTCAACTCAGAGTGGGAAAGG - Intronic
1063248914 10:4252840-4252862 ATGAGTTCACAGAGGTGGAATGG + Intergenic
1065009264 10:21406854-21406876 CTGACTTTTCAGTAGGAGAAAGG - Intergenic
1066732662 10:38449334-38449356 CTGACCTCTCAGCGTGGGAGGGG - Intergenic
1068330711 10:55563288-55563310 TTGACTTCTCAAAGGGGTAAAGG - Intronic
1068660968 10:59622958-59622980 CTCACTTGTCAGATGAGGAACGG + Intergenic
1069594749 10:69663307-69663329 GTGTCTTCTCAGTAGGGGAATGG + Intergenic
1070625207 10:78046175-78046197 CAGAATTCTCAGAGGCAGAACGG - Intronic
1070789924 10:79182920-79182942 CTCACTGCTCAGATGGTGAAGGG - Intronic
1071071149 10:81696025-81696047 CTGATTTCTCACATGGTGAAAGG + Intergenic
1072751569 10:97984315-97984337 ATGACTGCTCAGATGGGGGAGGG - Intronic
1072803300 10:98408028-98408050 CTGACATTTCAGAGGGATAAAGG - Intronic
1073267802 10:102238730-102238752 CTGCCTTCTTAGAGGTGTAATGG - Intronic
1073584103 10:104692176-104692198 CTTCCTTCTCAGTTGGGGAAGGG + Intronic
1073948662 10:108782587-108782609 CTGAATTCTCATAGGGTGACTGG + Intergenic
1074379701 10:112969152-112969174 CAGACTTTTCAGTGGGGGCAGGG - Intronic
1075043732 10:119129130-119129152 CTGGGTTCTCAGAGTGGAAATGG - Intronic
1075598520 10:123749743-123749765 CTGACTTTACAAAGGGTGAAAGG - Intronic
1076660439 10:132052269-132052291 CTGACTTCTTATAGGGACAATGG - Intergenic
1077680751 11:4237896-4237918 CTTACTTCTCAGATGGGGCGGGG - Intergenic
1078502955 11:11901116-11901138 TTGACTTCTGTGAGGCGGAAGGG + Intronic
1078869123 11:15327786-15327808 CAGCCTTCTTAGAGGGAGAAGGG + Intergenic
1080208576 11:29758269-29758291 CTGACTGTTCAGAGGGAGCATGG - Intergenic
1080404643 11:31967731-31967753 GTGGCTTCCCAGAGGGGGAAGGG - Intronic
1080878476 11:36297879-36297901 CTGACTCCTGGCAGGGGGAAGGG + Intronic
1081391137 11:42530221-42530243 CTGCCTTTTCAGCAGGGGAAAGG - Intergenic
1082065083 11:47893016-47893038 CTCACTTCTCAGACGGGGGGGGG - Intergenic
1083011337 11:59402963-59402985 CTTATTTCTCAGTGGGGGTAGGG - Intergenic
1083402105 11:62430685-62430707 CTGACTTTGAAGATGGGGAAGGG - Intergenic
1084926238 11:72514294-72514316 ATAACATCTCAGAGGAGGAAGGG + Intergenic
1085619611 11:78027957-78027979 CTGAATTCCAAAAGGGGGAAGGG + Intronic
1085816465 11:79742393-79742415 CTGGCTTCACAGAGGGGAAGGGG - Intergenic
1087796388 11:102458828-102458850 GTGACTTCTCAGAAAGGGAGTGG + Intronic
1087978141 11:104575909-104575931 CTGTGTTCTCAGAGGGGAGAAGG - Intergenic
1090206983 11:124890777-124890799 CTCACTTCTCAGAGAGGAATGGG - Intronic
1090488455 11:127136243-127136265 CTGGCTCCTCAAAGTGGGAAGGG - Intergenic
1091131005 11:133147260-133147282 CTGACCACTCAGAAGGGGAGAGG + Intronic
1091195970 11:133731001-133731023 CAGTCTTCTCACAGGAGGAAGGG + Intergenic
1091451132 12:572452-572474 CTGATTTCTCACAAAGGGAAAGG + Intronic
1091661023 12:2383756-2383778 CTGGCTTCTCACTGGGGCAAAGG - Intronic
1092870051 12:12798190-12798212 CTGACCTCTCAGAAGAGGACAGG + Intronic
1093583416 12:20808359-20808381 CTGAGTTCTCAGATGGGTACTGG - Intergenic
1093826097 12:23690949-23690971 CTGACTTTCCAGACTGGGAAGGG + Intronic
1094754937 12:33456792-33456814 CTGGCTTCCAAGAGGGGAAAAGG - Intergenic
1096123915 12:49106048-49106070 CTGCCTTCTTTGAGGGGGCAGGG - Intronic
1096802099 12:54117397-54117419 CTGATTTAGCAGAGGGTGAAGGG + Intergenic
1097029355 12:56080280-56080302 ATGACTCCGCAGAGGGTGAAGGG - Exonic
1097878404 12:64665027-64665049 CTGACTTTTTAGAGGTGGAAGGG - Intronic
1103528396 12:121582607-121582629 CTGGCCTGTCAGAGTGGGAAGGG + Intergenic
1104450211 12:128863005-128863027 GTGAACCCTCAGAGGGGGAAAGG - Intronic
1104752677 12:131250056-131250078 CTTATTTCCCAGAGGGAGAAGGG - Intergenic
1107996509 13:45866107-45866129 CTGACTTCACAGAGGGTTTATGG - Intergenic
1108325302 13:49324700-49324722 CTGACTTCACAGATGGGGTGAGG + Intronic
1109818084 13:67613955-67613977 AGGACTTCTCAGGGGGAGAAAGG - Intergenic
1110633912 13:77742944-77742966 TTGACTTGTCAGAAGGAGAAAGG - Intronic
1110930323 13:81207415-81207437 GTAAGTTCTCAGAGGGGGAATGG + Intergenic
1112139228 13:96619978-96620000 CCAGCTTCTCAGACGGGGAAGGG - Intronic
1114697708 14:24643364-24643386 CTGAGTCCTCAGAGTGTGAAAGG + Intergenic
1117319705 14:54609268-54609290 CTGACTTCAAAGATGGAGAAAGG + Intronic
1117707687 14:58488729-58488751 CTGGCATCTGTGAGGGGGAAGGG - Exonic
1118693179 14:68359610-68359632 CTGGCTTCTGAGAGAGGTAACGG - Intronic
1123986400 15:25650211-25650233 CTGTATTCTCACATGGGGAAAGG + Intergenic
1127930850 15:63596380-63596402 CTGGCTTCTCCAAGAGGGAACGG + Intergenic
1128713038 15:69886186-69886208 AACACTTGTCAGAGGGGGAAGGG + Intergenic
1129996110 15:80007640-80007662 CTGACTTCGCAGAGCAGGGATGG - Intergenic
1130043861 15:80429290-80429312 CTGACCTCTGAGAAGGGGAAAGG + Intronic
1130066275 15:80607611-80607633 CCACCTTCTCAGAGGAGGAAAGG + Intergenic
1131001944 15:88946056-88946078 CTGAATCTTCAGAGGGTGAAGGG - Intergenic
1132371642 15:101303487-101303509 CTGACTTCACAGAGAGGCCATGG + Intronic
1134220398 16:12348952-12348974 CTGTCTTCCCAGAGGGGCGATGG - Intronic
1134367766 16:13595172-13595194 CTGACTTCTCAGACACAGAAAGG + Intergenic
1135071299 16:19354194-19354216 GTGACTGCTCAGAGGGGCACTGG + Intergenic
1135139491 16:19909312-19909334 CTCACTTCTCAGGGTGGGCAAGG + Intergenic
1136710723 16:32234493-32234515 CTGAGGTGTGAGAGGGGGAATGG + Intergenic
1136757188 16:32694918-32694940 CTGAGGTGTGAGAGGGGGAATGG - Intergenic
1136810921 16:33175457-33175479 CTGAGGTGTGAGAGGGGGAATGG + Intergenic
1136817397 16:33285537-33285559 CTGAGGTGTGAGAGGGGGAATGG + Intronic
1136823961 16:33342066-33342088 CTGAGGTGTGAGAGGGGGAATGG + Intergenic
1137424379 16:48365465-48365487 CTGACTTCTCATGACGGGAAAGG - Exonic
1138539946 16:57682088-57682110 CTGACTTATGAGAGTGGGGACGG + Intronic
1138685441 16:58721181-58721203 CTGGCTTTTCAGAGGGGGAAGGG + Intronic
1141530072 16:84640203-84640225 CTTACCTCACAGAGGAGGAAAGG + Intergenic
1141900556 16:86987853-86987875 CAGACTTCTCAGTGTGGGCAGGG - Intergenic
1203059337 16_KI270728v1_random:955269-955291 CTGAGGTGTGAGAGGGGGAATGG - Intergenic
1143632272 17:8146167-8146189 CTGACTTCCCAGTGGGGGTGGGG - Intronic
1144334137 17:14254409-14254431 CTGAGCTCTCAGAGGGGTAGAGG + Intergenic
1144798616 17:17910290-17910312 CTCACATCCCAGAGGGGGAAGGG - Intronic
1147254846 17:39175397-39175419 CTGACCCCTCAGAGGGGCCAGGG - Exonic
1148855632 17:50577854-50577876 CTGGCTTCTGGGAAGGGGAAGGG + Intronic
1149868330 17:60162660-60162682 CTGACTTCTCTGAGGGTCACTGG + Intronic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1150591621 17:66567601-66567623 CTGACATCCCAGACTGGGAAAGG - Intronic
1151236606 17:72724641-72724663 CTGAAGTCTCAGAGTGGAAAAGG - Intronic
1151336630 17:73443787-73443809 CAGTCTTCTCAGGGGGGAAATGG + Intronic
1151810664 17:76439181-76439203 CTTACTTCACAGAGGAGGAGAGG - Intronic
1152283518 17:79399137-79399159 CTGGAGTCTCAGAGGGGGCATGG + Intronic
1153867993 18:9290883-9290905 CTGACTTCCCAAAGGGAGGAGGG - Intergenic
1156266331 18:35491426-35491448 CTGACTTCCCAGCGGGGGTCTGG - Intronic
1158010107 18:52718984-52719006 CTGAGTTTTCAGAGGGAAAATGG - Intronic
1158375508 18:56858862-56858884 CTGCCTTCTTGCAGGGGGAAGGG + Intronic
1159583948 18:70265074-70265096 CTGAATTCTAAGAAGGAGAAAGG - Intergenic
1159951771 18:74489265-74489287 CTGGCCTCTCAGAGGAGGACTGG + Intergenic
1160311213 18:77792258-77792280 CTGACTTTTCAGGGGGTAAAAGG - Intergenic
1160352777 18:78199071-78199093 AAGACCTCTCAGAGGGAGAAGGG - Intergenic
1160529982 18:79557094-79557116 CTGACTCCACAGACGAGGAAAGG + Intergenic
1160727620 19:624568-624590 CCATCTTCTCAGAGGAGGAAGGG + Intronic
1160841879 19:1149990-1150012 CTGACTTCTCAGAAGCTGCACGG + Intronic
1162367308 19:10257256-10257278 CTGCCTGGTCAGAGAGGGAAAGG - Intronic
1165661447 19:37584047-37584069 TTGACTTCTCTCAGGAGGAATGG - Exonic
1166545805 19:43634523-43634545 CTGACTCCTCAGGAGGGGGAGGG - Intronic
1166563602 19:43749661-43749683 CTGACATCTCTGAGGTGGACAGG + Intronic
926165700 2:10521328-10521350 CAGCCTTATCAGAGGGGCAAGGG + Intergenic
927604626 2:24475671-24475693 TAGACTTCTCAGAGGTGGAAAGG + Intergenic
927851232 2:26500979-26501001 CTGGCTGCTCAGAGGGGACAGGG - Intronic
927955404 2:27204318-27204340 CTAGCATCTCAGAGTGGGAAAGG + Intronic
928919547 2:36512413-36512435 CTGGCTGCTTTGAGGGGGAAGGG - Intronic
929802119 2:45112980-45113002 CTGGCTTCTCACATGAGGAAGGG + Intergenic
929962625 2:46507895-46507917 CTGACTTCCCGGAAGGGGAAGGG + Intronic
930119861 2:47751684-47751706 TTGACTTGTCAGAAGGGGACGGG + Intronic
931690025 2:64827763-64827785 CTGACCTCTCGGAAAGGGAAAGG - Intergenic
933159780 2:79010881-79010903 CTAACTATTCAGAGGGGGATAGG - Intergenic
936072673 2:109381761-109381783 CTCGCTTCGCAGAAGGGGAAGGG + Intronic
937804161 2:126118036-126118058 ATGAATTCACAGAGGTGGAAAGG + Intergenic
939818543 2:146927241-146927263 CCGACTTCCCAGAGGAAGAAGGG - Intergenic
940259593 2:151766116-151766138 CTGACCTCTCCCAGGGGGAACGG + Intergenic
941241792 2:163047808-163047830 TTGACTTCTTATAGGAGGAAAGG - Intergenic
941382601 2:164814207-164814229 CCGATTTATCAGATGGGGAAGGG - Intronic
942547060 2:177076157-177076179 CTTGCTTCTAAGATGGGGAAGGG + Intergenic
944420661 2:199526533-199526555 CTGGCTTCCCAGAGTAGGAATGG - Intergenic
947874527 2:233459514-233459536 CTGACTGCTCAGTGAGGGGATGG + Intronic
948045275 2:234938999-234939021 CTGACATCTCTGGGGTGGAATGG - Intergenic
948641327 2:239377661-239377683 CTGGCTTCTCACAAGGGGCAGGG + Intronic
948771055 2:240251430-240251452 CTGAGTCCTCAGCGGGGGAGGGG + Intergenic
1170132223 20:13032817-13032839 CTGACTTCTCAGGTGGTGAATGG + Intronic
1172125415 20:32622627-32622649 CTGCCTTGTCACAGGGGGACAGG + Intergenic
1172329513 20:34065477-34065499 CTGACTCATGAGAGTGGGAATGG + Intronic
1172771997 20:37387291-37387313 CTGCCTTCTCAGAGGGGCAAAGG + Intronic
1172980272 20:38936323-38936345 CTGACTTCGCAGAGCTGGAAGGG + Intronic
1173714736 20:45193271-45193293 TTGACTTCTCAGAAGAGAAATGG - Intergenic
1175507272 20:59494827-59494849 CAGAGTTCCCAGAGGAGGAAGGG - Intergenic
1178478177 21:32956049-32956071 CTGACAGCCCAGAGGGGGAAAGG + Intergenic
1180966321 22:19789589-19789611 CTGGGTTCTGAGAGGGGGTAGGG + Intronic
1182269689 22:29145591-29145613 CTGCCTTCTCAGAAGGGCCAAGG - Intronic
1183788699 22:40047215-40047237 TTGAATTATCAGAGGGAGAAAGG + Intronic
950503585 3:13379278-13379300 CAGCCTTCTCAGAGGGGGCCTGG - Intronic
950891148 3:16405524-16405546 ATGACTTTTCAGAGTGTGAAGGG - Intronic
951962639 3:28346644-28346666 CTAACTTTTCAGAGGTAGAAAGG - Intronic
952678302 3:36060183-36060205 CTGACTTCTAAAAGGGGAAAAGG + Intergenic
952711207 3:36433691-36433713 CTGACTTCTCAGAGCTGGAAGGG + Intronic
952987818 3:38802246-38802268 CTTACTTTTCAGAGGAGAAAAGG + Intergenic
953202463 3:40789709-40789731 CTGACTTTGAAGAAGGGGAAAGG + Intergenic
955088784 3:55729191-55729213 GTGAGTTGTCAGAGTGGGAATGG - Intronic
955509644 3:59666437-59666459 CTGAATTGTCAGAAGGGAAAGGG - Intergenic
957989868 3:87614340-87614362 CTGATTTCTTAGAGGTGGAGGGG + Intergenic
958778671 3:98515293-98515315 CTTATTTCTAATAGGGGGAAGGG + Intronic
959093350 3:101927342-101927364 CAGACTTCTGAGAGGGTCAATGG + Intergenic
959596173 3:108131172-108131194 CTAAGTTGTCAGAGGTGGAATGG - Intergenic
960593307 3:119386404-119386426 CTGTGTTCTCACATGGGGAAAGG + Intronic
961097359 3:124169200-124169222 CTGACCCCTCAGAAAGGGAAAGG - Intronic
962088254 3:132214401-132214423 CTGAGTCCTCACAGGTGGAAGGG - Intronic
963080424 3:141387593-141387615 TTGAACTCTCAGAGGAGGAAGGG + Intronic
963571058 3:146996518-146996540 CAGACCTCTCAGATGGGAAAGGG - Intergenic
963638144 3:147825356-147825378 GGGACTTCTTAGAAGGGGAATGG - Intergenic
964358658 3:155871590-155871612 CTTCCTTCTCAGAGAGGAAAGGG + Intronic
964667698 3:159192020-159192042 GTCACTTCTCTGAGGAGGAAAGG - Intronic
965770101 3:172173082-172173104 CTGACTTCTGAAAAGGGGAAAGG - Intronic
966200667 3:177357560-177357582 CTGTCTTCTCAGAGCTAGAAAGG + Intergenic
966812317 3:183858003-183858025 CTCATTTCTCAGATGGGGCAAGG - Intronic
966821369 3:183927372-183927394 ATAACTTCTCAGTGGGGGAACGG - Exonic
968170541 3:196506183-196506205 CTGACTTCTCAGAGGCTGCTAGG + Intergenic
969149797 4:5159951-5159973 CTGACTTCCCAGGAGAGGAAGGG - Intronic
971144040 4:23957200-23957222 CTGACTGCTGAGAGGGGAGAAGG - Intergenic
971721824 4:30255238-30255260 CTGAGGTCTCATTGGGGGAAAGG + Intergenic
973650934 4:52996542-52996564 TTTATTTCTCAGAAGGGGAAGGG - Intronic
973715550 4:53672306-53672328 CTTACTTCTGTGAGGGGGACAGG - Intronic
979094540 4:116530050-116530072 CTGCCTTCTTAGAGACGGAAAGG - Intergenic
980113384 4:128655853-128655875 CTGCCTTCTAAGAGGAGCAAAGG + Intergenic
981563268 4:146070193-146070215 CTGTGTCCTCAGTGGGGGAAGGG - Intergenic
981714168 4:147736602-147736624 CTGGATTGTCAGAGGGGAAAAGG - Intronic
982479286 4:155889602-155889624 CTCACTTCACAGATGGGAAACGG - Intronic
982986719 4:162218266-162218288 GTGACTTCACTGAGGGGGGATGG + Intergenic
987240676 5:15995453-15995475 CTGACCTCTCATAGAGGGCAAGG + Intergenic
987347861 5:16994567-16994589 CTGACAGCTGAGAGGGAGAAAGG + Intergenic
987632862 5:20497977-20497999 CTGTGTTGTCACAGGGGGAAAGG - Intronic
988670196 5:33372879-33372901 CTGTCTTCTCATAGTGGGATGGG + Intergenic
988877943 5:35468989-35469011 CTGTCCTCTCACAGGGGGCAGGG + Intergenic
990051643 5:51508907-51508929 CTATGTTCTCAAAGGGGGAAGGG + Intergenic
992216032 5:74525412-74525434 CTGACAACTCAGTGGGGGAATGG - Intergenic
993900722 5:93582744-93582766 CTCACACCCCAGAGGGGGAAGGG - Intergenic
994726801 5:103445757-103445779 ATTTCTTCTCAGAGGGAGAAAGG - Intergenic
995594347 5:113731725-113731747 CTGAATTCTAAAAGGGAGAAGGG + Intergenic
996520277 5:124418453-124418475 CTCACTCCTCAGAGGGGCATAGG - Intergenic
996787566 5:127256803-127256825 GTGAGTTTTCAGAGGGTGAAGGG - Intergenic
999320909 5:150614476-150614498 CTGACCCCTCAGAGGGAGCAGGG + Intronic
999767821 5:154754872-154754894 CTGACTTCTAGGAGGCCGAAGGG - Intronic
999770899 5:154774725-154774747 CTGGCACCTCAGAGGGGCAATGG - Intronic
1000898261 5:166882414-166882436 TGGGTTTCTCAGAGGGGGAAAGG + Intergenic
1001419259 5:171574315-171574337 CTGGCCTCTCAGAGCTGGAAGGG - Intergenic
1001633862 5:173196071-173196093 GTGAGTTGTCAGAGGGAGAAAGG + Intergenic
1001721506 5:173860692-173860714 CTGCCTGCTCTGTGGGGGAAGGG - Intergenic
1002048098 5:176553300-176553322 CTGACGTCCAAGAGGGGAAAGGG - Intronic
1002065730 5:176650804-176650826 GTGCAGTCTCAGAGGGGGAAAGG - Intronic
1003458841 6:6310272-6310294 CAGATATCTCAGAGGGGCAATGG + Intronic
1006422651 6:33945000-33945022 CAGGCTTCACACAGGGGGAAGGG + Intergenic
1007305900 6:40904300-40904322 CTGTATTCTCACAGAGGGAAGGG - Intergenic
1007401615 6:41605750-41605772 CTGACTACTCAGAAGGTTAAGGG + Intergenic
1009366538 6:62861430-62861452 CTTACTTCCCAAATGGGGAAGGG + Intergenic
1010015838 6:71104253-71104275 CTGTGTTCTCAGTGGTGGAAGGG - Intergenic
1014153245 6:118082987-118083009 GTGGCTCCTCAAAGGGGGAATGG + Intronic
1014512571 6:122342212-122342234 CTGGCTTCACAGATGGAGAATGG + Intergenic
1015292082 6:131548585-131548607 CTCAATTCTGATAGGGGGAATGG + Intergenic
1016873656 6:148843124-148843146 TTGACTGATCACAGGGGGAATGG + Intronic
1017088191 6:150734178-150734200 ATGTCTTCTAAGAGGCGGAAGGG + Intronic
1018131284 6:160734433-160734455 CTTACTTCTCAGCTGTGGAAAGG - Intronic
1019304418 7:326156-326178 CTGCCTTCACTGAGAGGGAACGG - Intergenic
1020158928 7:5752921-5752943 CTGACTCCTCAGATGAGGAAAGG - Exonic
1020247132 7:6438456-6438478 CTAACCTCTCTGAGGGGGAAAGG + Intronic
1020398079 7:7740643-7740665 ATGACTTCTCAGTAGGGAAAGGG - Intronic
1025981625 7:66411904-66411926 CTGATCACTCAGAGGGGGAAAGG + Intronic
1026445869 7:70484337-70484359 CTGACTTCTAAGAGTGGAAATGG - Intronic
1027400364 7:77799482-77799504 CCGCCTGCTCAGAGGGGGCAGGG - Intronic
1029382228 7:100221648-100221670 CTGGCTTCTCAGAGTGGCAGGGG + Intronic
1030445451 7:109643200-109643222 CTGAATTCTGAGAAGGGCAAGGG + Intergenic
1030454243 7:109752852-109752874 CTGACTTCACATAGTGGAAAGGG - Intergenic
1030635793 7:111947400-111947422 CTGACTTCTCATATGAGAAAGGG + Intronic
1031743032 7:125457921-125457943 CTGACTTCTCAGAGTGGCTGGGG - Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1032545484 7:132738221-132738243 CTGACATCTCAGATGGGGCCTGG + Intergenic
1033948321 7:146750707-146750729 CTGACTTTTGAGAGGTGGCATGG + Intronic
1034524481 7:151648507-151648529 GTGTCTTCTCAAAGGGTGAAAGG + Intronic
1037017415 8:13925782-13925804 CTGGCTTCTCACAGGAGGAGGGG - Intergenic
1037535196 8:19817301-19817323 CTGGCTTCTCAGAAGAGGAGGGG + Exonic
1037879779 8:22566911-22566933 CTGCCATCCCAGAGGGGGATGGG + Intronic
1039429926 8:37517758-37517780 CTGACTTTTATGTGGGGGAAGGG - Intergenic
1043098411 8:76006184-76006206 CTGCCTTCTCACATGGGGGAAGG - Intergenic
1043569804 8:81589755-81589777 CTGCCTGCACAGAGGGGAAAAGG - Intergenic
1044184907 8:89239752-89239774 CTTTCTTCTCAGGGGAGGAAAGG - Intergenic
1046376566 8:113389831-113389853 CTCACTTTTCAAAGAGGGAAGGG - Intronic
1048369630 8:133766236-133766258 CTGACTTCGCAGCTGGGGAGAGG + Intergenic
1049265952 8:141668015-141668037 CTGACTGCTCACTGGGGGGATGG + Intergenic
1049367257 8:142246410-142246432 CTGACTCCTCAGATGGGGGCAGG - Intronic
1050507332 9:6361723-6361745 CTTAATTCTCAGAGGTGGGATGG - Intergenic
1054153519 9:61624280-61624302 CTGATTTAGCAGAGGGTGAAGGG - Intergenic
1054799381 9:69332004-69332026 CAGAATTCACAGACGGGGAAAGG - Intronic
1056066744 9:82943430-82943452 CTGACTTCCCAGAGAGGTGATGG + Intergenic
1056964530 9:91154915-91154937 CTGACTCCTCATAGTGGGAAGGG - Intergenic
1057909059 9:99004222-99004244 CTGACTACTGAGAGGAGAAAGGG + Intronic
1058641402 9:107088941-107088963 CTGACACCACAGAGGTGGAAGGG - Intergenic
1058676400 9:107403961-107403983 CTCACTTCTTAGAGGGGTGAAGG - Intergenic
1059060173 9:111027568-111027590 CTGACTTCTTAGATGAGGACAGG - Intronic
1059434871 9:114270086-114270108 CCTACTTCTCAGATGAGGAAAGG - Intronic
1060050029 9:120371952-120371974 CTGACAGCTCAGAGAGGGAAAGG - Intergenic
1060956262 9:127642888-127642910 CTGCCCTCTCAGAAGGGGACGGG + Intronic
1061498227 9:130987804-130987826 CTGACATCAGAGAGGGGGAGTGG + Intergenic
1203577869 Un_KI270745v1:21948-21970 CTGACCTCTCAGCGTGGGAGGGG - Intergenic
1188484495 X:30668453-30668475 CTGAGCTCTCAGAGGGCAAAAGG + Intronic
1190106940 X:47567580-47567602 CTCATTTCCCAGAGGGGAAAGGG - Intronic
1190477411 X:50841694-50841716 TTGACTCCTCAGAAGTGGAAGGG + Intergenic
1191227116 X:58055062-58055084 CAGACTTCTCAGATGGGGGCAGG - Intergenic
1192223739 X:69214686-69214708 CTGGCTTCTCAGTGGGGAACTGG - Intergenic
1192464427 X:71343956-71343978 CTGGCTTCTCAAAAGGGAAATGG + Intergenic
1193348613 X:80431860-80431882 CTGGCTTCTCACATGGGAAAAGG + Intronic
1196062628 X:111427361-111427383 ATGACTTCTTAGAAGGAGAAAGG + Intergenic
1197272843 X:124444711-124444733 CTGAGTACTCAGAGGTAGAATGG - Intronic
1198120835 X:133590968-133590990 CTGACTTTTCAAAAGTGGAAGGG + Intronic
1199555625 X:149105516-149105538 CTGACTTCTCCTAGGGGAAGGGG + Intergenic
1202240205 Y:22759475-22759497 CTGCCTTCTGAAAGGGGAAAAGG + Intergenic
1202393191 Y:24393229-24393251 CTGCCTTCTGAAAGGGGAAAAGG + Intergenic
1202477594 Y:25276871-25276893 CTGCCTTCTGAAAGGGGAAAAGG - Intergenic