ID: 904809496

View in Genome Browser
Species Human (GRCh38)
Location 1:33154157-33154179
Sequence GCTCATTTAAGATCTAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904809496 Original CRISPR GCTCATTTAAGATCTAAAGA TGG Intronic
901565159 1:10107982-10108004 CCTCATTTTAGATCTAAAGGTGG - Intronic
901892960 1:12283756-12283778 GCTCCCTTAAGCTCTAAAAATGG + Intronic
904579623 1:31532222-31532244 GGACATTTAATTTCTAAAGAGGG - Intergenic
904809496 1:33154157-33154179 GCTCATTTAAGATCTAAAGATGG + Intronic
906622331 1:47292897-47292919 TCTCATTTAATAGATAAAGAAGG + Intronic
906622332 1:47292948-47292970 ACTCATTTAATAGATAAAGAAGG - Intronic
908828323 1:68154890-68154912 GCCCATTTAAAATCTTAAGTGGG + Intronic
909996329 1:82284416-82284438 GCTATTTTAAGATGTAAAGGAGG - Intergenic
911004523 1:93204825-93204847 GCTGTTTTGAGAGCTAAAGAGGG + Intronic
911965491 1:104364153-104364175 ACTCATTTAAAATATAAAAAAGG + Intergenic
913507472 1:119530962-119530984 TCTCATTTAAGTTTTAAAGTGGG - Intergenic
919274281 1:195392514-195392536 ACTTATTTAAGATTTAGAGAAGG + Intergenic
919336974 1:196248052-196248074 GCTCAATGAAGATATTAAGAAGG + Intronic
921115505 1:212087244-212087266 GCTCTGTTAGGTTCTAAAGAAGG - Intronic
921156504 1:212443039-212443061 GCTCATTTAAAATGGAAGGAAGG - Intronic
921868204 1:220108820-220108842 AGACATTTAAGACCTAAAGAAGG - Intronic
923984570 1:239366737-239366759 GCGTATTTAAGATCTAGAAATGG + Intergenic
924484572 1:244468467-244468489 GGTCATTTATGAATTAAAGATGG - Intronic
1064635767 10:17365300-17365322 TCTCAATTAAGATATAAATAGGG + Intronic
1066147444 10:32576234-32576256 GCTCATTTAAAAGCAACAGATGG - Intronic
1070444363 10:76481068-76481090 GGTCCATTAAGATGTAAAGATGG + Intronic
1071560194 10:86640162-86640184 GGTCATTTAATATCAAAGGAAGG - Intergenic
1075226118 10:120630767-120630789 GCTCTTTTCAGACCTAAAAAGGG - Intergenic
1075243173 10:120796927-120796949 GGTCATTTAACCACTAAAGATGG + Intergenic
1075935721 10:126339568-126339590 TCTCCTTTAAGATTGAAAGAGGG - Intronic
1079722981 11:23842795-23842817 GCTCAATAAAGAAATAAAGAAGG - Intergenic
1081148160 11:39590519-39590541 ACTCACTGAAGATCTCAAGATGG + Intergenic
1081225439 11:40516527-40516549 TCTCTCTTAAGTTCTAAAGAAGG + Intronic
1082662673 11:55932166-55932188 GCTCTTTTTAAATATAAAGATGG + Intergenic
1082923035 11:58516470-58516492 GCACTTTTATGTTCTAAAGATGG + Intergenic
1085645690 11:78220983-78221005 GCTCCTCCAAGATCTGAAGAGGG + Intronic
1086105179 11:83139697-83139719 GCTCTTTCAAGATCTAAGAATGG - Intergenic
1087371670 11:97292717-97292739 GCTTATTTGAGGACTAAAGAGGG + Intergenic
1088076836 11:105860248-105860270 GCTCAGTTAAGATCAACAGATGG - Intronic
1094773271 12:33690924-33690946 GCTCATTTAGGATGTAGACAAGG + Intergenic
1095673159 12:44884765-44884787 GCACATTTACAACCTAAAGAAGG + Intronic
1099351336 12:81572784-81572806 GCTGATTTCAGGTCTAAAGAAGG + Intronic
1099736984 12:86580840-86580862 ACTCATTTAAGAGCAAAAAAGGG + Intronic
1099783860 12:87236074-87236096 GGACATTTAAGAACTCAAGAAGG - Intergenic
1100310007 12:93385586-93385608 GCTAATTAATGCTCTAAAGATGG - Intronic
1100775006 12:97964152-97964174 GCTTATTTGAGATTTAAATAGGG + Intergenic
1100928840 12:99583074-99583096 AGTGCTTTAAGATCTAAAGATGG + Intronic
1102514692 12:113438431-113438453 GCCCATTTAAGATCTCATAATGG - Intergenic
1104701874 12:130911112-130911134 GCTCCTTTTATATCTACAGATGG - Intergenic
1105424547 13:20283339-20283361 GCTCATCTAGGATCTGCAGAAGG + Intergenic
1105761561 13:23520130-23520152 ACTCATCTCAGATCTAACGATGG - Intergenic
1108139452 13:47403888-47403910 GCTCATTTAATAACTTAGGAGGG + Intergenic
1108280041 13:48852223-48852245 GCTAATTTAAGAGTTAAAGAGGG + Intergenic
1108508326 13:51133432-51133454 ACTCATTTTACACCTAAAGATGG + Intergenic
1110941095 13:81349864-81349886 GGTAAATTAAGATTTAAAGAAGG + Intergenic
1111826527 13:93275242-93275264 GTTCATTTAAGATCTTAATTGGG + Intronic
1116840571 14:49817107-49817129 GCTCCTTTAAAATATAAGGATGG + Intronic
1117868525 14:60174135-60174157 GATCATTTAATATATCAAGATGG - Intergenic
1120408616 14:84121401-84121423 GCTTATTGAAAATCTAAATAGGG + Intergenic
1120984667 14:90324104-90324126 TCTCAGCTAAGATCTAAAGGAGG + Intronic
1130777209 15:86997140-86997162 AATCATTTAAGTTCAAAAGAAGG - Intronic
1131634153 15:94212338-94212360 GCTCATTTAAGATCTTCAATAGG - Intergenic
1133857571 16:9564127-9564149 CCTTATTTATGATATAAAGAAGG + Intergenic
1133894622 16:9914615-9914637 GCTTATTGAAGATGGAAAGATGG + Intronic
1137308713 16:47231872-47231894 TGTCATTAAAGATCTCAAGATGG + Intronic
1137663120 16:50227034-50227056 ACTGATTTGAGATCTAAAGCAGG + Intronic
1139866065 16:70063852-70063874 TCTCAATGAAGATCTCAAGAGGG - Intergenic
1146770678 17:35566083-35566105 GATCATTCACAATCTAAAGAGGG + Intergenic
1147441657 17:40451217-40451239 GCACATTTAAAATCCCAAGAAGG - Intronic
1148288754 17:46421236-46421258 AGGAATTTAAGATCTAAAGAAGG + Intergenic
1148310923 17:46638813-46638835 AGGAATTTAAGATCTAAAGAAGG + Intronic
1148631465 17:49113036-49113058 GGTCATTCAATATCTAAGGAGGG - Intergenic
1156183426 18:34633258-34633280 TCTCATTTGAAATCTAAAGTCGG + Intronic
1156611368 18:38728981-38729003 GCTCATCTTGGCTCTAAAGAAGG + Intergenic
1157155347 18:45260174-45260196 GCTCAATAAATATCTAATGATGG - Intronic
1158917328 18:62147352-62147374 TCTCATTTAGGACCTAAAAAGGG - Intronic
1162633383 19:11946206-11946228 GCTCATTTACGATCTAAGACTGG - Intronic
1163492332 19:17624058-17624080 GCTCATTCAAAAGCCAAAGAGGG - Intronic
1163966844 19:20753992-20754014 GCTCATTTAAGACCCAAAACAGG - Intronic
1165604269 19:37086829-37086851 GCACATTTTAAATATAAAGATGG - Intronic
1167710876 19:51109713-51109735 GCTCATTTAATATGAAAGGAAGG - Intergenic
926271368 2:11369148-11369170 ACTCATTTCAGACCTGAAGAAGG + Intergenic
927534066 2:23838215-23838237 TCTCATTCAAGATATAAAGGGGG + Intronic
930594302 2:53367194-53367216 GCTAATTTATGCTCTAAAGCTGG + Intergenic
931012533 2:57933613-57933635 ACTCACTTAAAATCTTAAGAAGG - Intronic
932017992 2:68052652-68052674 GCTCAGTTCAGATTTAATGAGGG - Intronic
932391194 2:71392145-71392167 GCTAATTGAAAATCTAGAGATGG - Intronic
934713295 2:96529178-96529200 GCTCAATGAAGATCCACAGAAGG - Intergenic
939217936 2:139263727-139263749 GCTCATTTAAACTCTAATAATGG + Intergenic
940465109 2:154017850-154017872 ACTCATTTCAGATCTTTAGAAGG - Intronic
940480798 2:154228294-154228316 GGTCAATTAAGATGTAAAAATGG - Intronic
940876211 2:158900281-158900303 TTTCATTTAAGTTCTAAACAAGG - Intergenic
942379183 2:175370398-175370420 GCTCATTGAATATCTATTGATGG + Intergenic
944799967 2:203229583-203229605 GCTCATTTATGTTCTATATATGG - Intergenic
945533846 2:210987602-210987624 AATCACTTAGGATCTAAAGAGGG + Intergenic
1169640729 20:7748229-7748251 GCTAAATTAAGATTTAAATAAGG - Intergenic
1169890791 20:10450056-10450078 GCTCATTTATGATCTATCCAAGG + Intronic
1170478928 20:16745721-16745743 GCTCCTTTAGGATCTAAGCATGG - Intergenic
1171407409 20:24920851-24920873 GCTCATTTAAGACCCAAAACTGG + Intergenic
1177041958 21:16123790-16123812 ATTCATTTAAGATCAAATGAAGG + Intergenic
1178237213 21:30856887-30856909 GCTCTTTTAAGAATTAAAGCAGG + Intergenic
1178833639 21:36077731-36077753 GCTCTGTTAGGATCAAAAGAGGG + Intronic
1181471585 22:23143781-23143803 GCCCACTTAAGAGCTAAAGGAGG + Intronic
1183237582 22:36631127-36631149 GCCCATTAAAGAGCTCAAGAGGG - Intronic
1183255354 22:36758238-36758260 GCTCTTTTAATATATAATGATGG - Exonic
949362771 3:3249253-3249275 GCTTATTTACTATCTTAAGATGG + Intergenic
949669843 3:6387374-6387396 GCTCATTCAACATCTAAAGAAGG + Intergenic
952061750 3:29519245-29519267 CCTCATTTAGGTTCTACAGATGG - Intronic
952684008 3:36129409-36129431 GCTCATTCAGGATCTTCAGAAGG + Intergenic
955043813 3:55341070-55341092 TCTTATTTTAGATCTACAGAGGG + Intergenic
961893325 3:130148105-130148127 GCTCATTTAAGACCCAAAACGGG - Intergenic
962156600 3:132954953-132954975 GCCCATTTAAAAACTAAATATGG + Intergenic
963207753 3:142653938-142653960 GCTAAATGAAGATATAAAGATGG - Intronic
963739723 3:149065231-149065253 CCTCATTAAAGATCTGAACATGG - Intronic
964925940 3:161957305-161957327 TGTCATTTAACATCTAAAGAGGG + Intergenic
965045764 3:163574387-163574409 CCTCATTAAAGAACTAAATAAGG + Intergenic
965667980 3:171116299-171116321 GCTCAGTTAAGATGTGAACAAGG - Intronic
968015683 3:195330389-195330411 ACTTATTTGAGATCTAGAGAGGG + Intronic
968932850 4:3591665-3591687 GCTCAATTATGATCAGAAGATGG - Intergenic
971152322 4:24046449-24046471 ACTCATTTATGATACAAAGAGGG - Intergenic
974737702 4:65959584-65959606 GGGCTTTTAAGATCTAAACAAGG - Intergenic
976901720 4:90185525-90185547 TCTCATTTGAGACCTAAAGAAGG + Intronic
976902376 4:90194949-90194971 TCTCATGTAAGATATAAAAAAGG + Intronic
980060245 4:128120772-128120794 GCTGTTTTAAGTTCTATAGAAGG + Intronic
980063676 4:128158058-128158080 ACTTATTCAAGATATAAAGATGG + Intronic
981086230 4:140687414-140687436 GCTCATTCCAGAACTAAAGAAGG + Intronic
981989150 4:150895022-150895044 CCTCATTTAAAAATTAAAGAAGG + Intronic
982536880 4:156617945-156617967 GCACATTTAAGTACTAAAGTAGG - Intergenic
985274642 4:188225938-188225960 GCTTATTCAAGAACTCAAGAGGG + Intergenic
986333107 5:6732414-6732436 GCTATTTTAAGAGCAAAAGAAGG - Intronic
986936756 5:12897953-12897975 GCTCATTGAAAATCTTAAGGCGG - Intergenic
994691886 5:103029920-103029942 GCTCTTCTAAAATCCAAAGAGGG + Intronic
997008015 5:129842926-129842948 ACTCATTTAATATCTAACAATGG - Intergenic
997727067 5:136130718-136130740 GCTCAGTTTAGGTCTAAAGTTGG - Intergenic
1000442222 5:161277585-161277607 GCTCCTTTAAGCTATGAAGATGG - Intergenic
1001559841 5:172661817-172661839 GCTCTTTTTAGATCAAAGGAAGG + Intronic
1004483955 6:16048084-16048106 GATCATTGAAGATCTCAAGAAGG - Intergenic
1005203733 6:23377237-23377259 GATCATTTAAGAGCTTTAGAAGG - Intergenic
1006196438 6:32245531-32245553 GCTCAGTTGAGCTCTAAACAGGG - Intergenic
1007166809 6:39834239-39834261 TCTCATTTCAGATTTAGAGAGGG + Intronic
1007977626 6:46117494-46117516 GCTCTTTTAATATCTTAAGTGGG + Intergenic
1008142426 6:47847197-47847219 AGCCATTTAAGATATAAAGATGG - Intergenic
1008787106 6:55182089-55182111 GCTCATTTAACATCTGAGGTGGG + Intronic
1012989046 6:105906195-105906217 TCTCATTCAAGGTCTAAAGTGGG - Intergenic
1013995234 6:116300943-116300965 GATCATTTAAGCTCTTAAGATGG - Intronic
1015138351 6:129900242-129900264 GGTAATTTTAGAACTAAAGATGG - Intergenic
1016388677 6:143553521-143553543 GTTCATCTAACATCTGAAGATGG - Intronic
1018081707 6:160264519-160264541 GCTGATTTCAGATCAGAAGAAGG + Intronic
1022231987 7:28423274-28423296 GCTCAGTTAATATTTAATGAAGG - Intronic
1022780148 7:33573377-33573399 GCTTTTTTAACATCTAAAAATGG + Intronic
1023950628 7:44841353-44841375 GAACATTTAAGATCTGAGGAAGG - Intronic
1025522025 7:61747396-61747418 GTTCTTTTAAAATCTACAGAGGG - Intergenic
1031482693 7:122298376-122298398 GCTCATGTCTGATCAAAAGAAGG + Intergenic
1032759612 7:134927706-134927728 GCACATTTTAGAGCAAAAGAGGG + Intronic
1035854428 8:2959038-2959060 GCTAATTTAAGATTCAATGATGG + Intronic
1040923054 8:52645660-52645682 TTTCATTTGAGAACTAAAGAAGG - Intronic
1041625177 8:60017447-60017469 CCTCTTTTGAGACCTAAAGATGG - Intergenic
1043332021 8:79129485-79129507 GTCCATTTAGGATCTGAAGAGGG + Intergenic
1044848027 8:96400517-96400539 CCTCATCAAAGATCTACAGATGG + Intergenic
1044965504 8:97570125-97570147 GGTCATTTAAAATGTAAATATGG - Intergenic
1046270783 8:111895154-111895176 ACCCATTTAAAATCTAAAGAAGG - Intergenic
1047635736 8:126760091-126760113 GCTAATTTTAGATATTAAGATGG - Intergenic
1047696030 8:127404639-127404661 GCTCATTTGAGATCATTAGAGGG + Intergenic
1047785953 8:128154014-128154036 GCTCTTTAAACATCTGAAGAAGG - Intergenic
1050514089 9:6424611-6424633 ACTAACTTAAGATCTTAAGAGGG - Intronic
1051010612 9:12408900-12408922 GCACATTTAATGACTAAAGAGGG + Intergenic
1052399092 9:27978207-27978229 GCTCATTTAGAATCTAAAGAAGG - Intronic
1054457278 9:65440229-65440251 GCTCAATTATGATCAGAAGATGG + Intergenic
1061564625 9:131429961-131429983 TCTCCTTGAAGATCTGAAGATGG - Intronic
1186255440 X:7713332-7713354 GCTCAGGCATGATCTAAAGATGG - Intergenic
1187031687 X:15494389-15494411 TTACATTTAAGATCAAAAGAAGG - Intronic
1188749833 X:33891706-33891728 GCTCATTTAAACTCGAAAAAAGG - Intergenic
1193057619 X:77170574-77170596 GGTCATTTAAATTGTAAAGAAGG + Intergenic
1194578268 X:95640246-95640268 ACTCATTTAACATTTACAGAGGG + Intergenic
1199407532 X:147479926-147479948 GCTCATTTAAAAATGAAAGATGG - Intergenic