ID: 904810663

View in Genome Browser
Species Human (GRCh38)
Location 1:33161524-33161546
Sequence CAGGAAGAACTGCTGGCGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 183}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904810655_904810663 1 Left 904810655 1:33161500-33161522 CCCCGACGCGCGGCTGCTGGCCT 0: 1
1: 0
2: 0
3: 4
4: 100
Right 904810663 1:33161524-33161546 CAGGAAGAACTGCTGGCGGTGGG 0: 1
1: 0
2: 0
3: 19
4: 183
904810652_904810663 5 Left 904810652 1:33161496-33161518 CCCTCCCCGACGCGCGGCTGCTG 0: 1
1: 0
2: 1
3: 8
4: 137
Right 904810663 1:33161524-33161546 CAGGAAGAACTGCTGGCGGTGGG 0: 1
1: 0
2: 0
3: 19
4: 183
904810657_904810663 -1 Left 904810657 1:33161502-33161524 CCGACGCGCGGCTGCTGGCCTGC 0: 1
1: 0
2: 0
3: 8
4: 92
Right 904810663 1:33161524-33161546 CAGGAAGAACTGCTGGCGGTGGG 0: 1
1: 0
2: 0
3: 19
4: 183
904810653_904810663 4 Left 904810653 1:33161497-33161519 CCTCCCCGACGCGCGGCTGCTGG 0: 1
1: 0
2: 0
3: 15
4: 152
Right 904810663 1:33161524-33161546 CAGGAAGAACTGCTGGCGGTGGG 0: 1
1: 0
2: 0
3: 19
4: 183
904810656_904810663 0 Left 904810656 1:33161501-33161523 CCCGACGCGCGGCTGCTGGCCTG 0: 1
1: 0
2: 0
3: 14
4: 138
Right 904810663 1:33161524-33161546 CAGGAAGAACTGCTGGCGGTGGG 0: 1
1: 0
2: 0
3: 19
4: 183
904810650_904810663 11 Left 904810650 1:33161490-33161512 CCTGTTCCCTCCCCGACGCGCGG 0: 1
1: 0
2: 0
3: 6
4: 114
Right 904810663 1:33161524-33161546 CAGGAAGAACTGCTGGCGGTGGG 0: 1
1: 0
2: 0
3: 19
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904810663 Original CRISPR CAGGAAGAACTGCTGGCGGT GGG Intronic
901377489 1:8849579-8849601 CAAGAAGGACAGCTGGGGGTGGG + Intergenic
902880989 1:19371731-19371753 GTGGAGGAACTGCAGGCGGTAGG - Intronic
903623195 1:24713093-24713115 GAGGAAGAACAGCTGGCTGATGG - Intergenic
904616090 1:31750721-31750743 CAAGAAGCACTGCTGGGGATGGG - Intronic
904810663 1:33161524-33161546 CAGGAAGAACTGCTGGCGGTGGG + Intronic
905389691 1:37628518-37628540 CAGGAAGATCTCCTGCCTGTGGG + Intronic
907485425 1:54774721-54774743 CAGGAAGCACTGCTGGGGAGTGG + Intergenic
908802903 1:67898338-67898360 CAGGGAGATCTGGTGGCAGTGGG + Intergenic
913320058 1:117581828-117581850 GAGGAAGAACAGCTAGCAGTGGG - Intergenic
915319101 1:155046448-155046470 CAGGAAGGAGTGGTGGCGGATGG - Exonic
917154547 1:171982870-171982892 TAGGTAGAACTGATGGTGGTGGG - Intronic
918802635 1:188991433-188991455 CTGGAAGACCAGCTGGTGGTTGG - Intergenic
918958852 1:191244820-191244842 CAGGAAGAATAGCTAACGGTTGG - Intergenic
920443108 1:205994510-205994532 CAGGAAGAAGAGATGGGGGTGGG + Intronic
922775963 1:228214284-228214306 CAGGAGGAAGTGGTGGCGGGGGG + Exonic
923786145 1:237071165-237071187 CAGGAAGACCTGCCTGCGGAAGG - Intronic
1063302919 10:4868205-4868227 CAGGAAGAACTTCTCTCTGTGGG - Intergenic
1063895375 10:10676046-10676068 GAAGAGGAACTGCTGGTGGTAGG + Intergenic
1065593797 10:27292980-27293002 CAGGAAGAACTGCTTTCAGGGGG - Intergenic
1065656553 10:27957280-27957302 CAGGAAGAACTGCTTTCAGGGGG + Intronic
1070305010 10:75234725-75234747 CAAGACGAGCTGCTGGCGGCGGG - Exonic
1070813147 10:79308336-79308358 CAGGAAGAACAGTTGGAGTTTGG + Intronic
1072634596 10:97169707-97169729 CAGGAAGAAGTGGTGGGTGTGGG - Intronic
1073240550 10:102055352-102055374 GAGGAAGAACTGCGGAGGGTCGG + Intronic
1074826449 10:117218428-117218450 CAGGAAGAAATGCTGTCCCTGGG + Intergenic
1076212073 10:128657093-128657115 AAGGAAGAACTGGGGGCTGTTGG - Intergenic
1077111973 11:865948-865970 CAGGAGAACCTGCTGGCTGTGGG + Exonic
1078874593 11:15380187-15380209 AAGGAAGAACTGGTGGGGGGTGG + Intergenic
1079041868 11:17066881-17066903 CAGTTAGAACTGCTGGCAGTGGG - Intergenic
1079229413 11:18636690-18636712 CAAGAACAACTGCTGGAGGTGGG + Intergenic
1079315036 11:19400315-19400337 CAGGTAGAACCTCTGGTGGTGGG + Intronic
1080049714 11:27847124-27847146 CAGGGAGCTCTGCTGGGGGTTGG + Intergenic
1080557046 11:33427384-33427406 CAGGGGGAACTGCTGGCAGGAGG - Intergenic
1081684535 11:45032927-45032949 CAGGAAGACCTCCTGGAGGAGGG - Intergenic
1083743638 11:64723520-64723542 CGCGAAGACCTGCTGGCCGTGGG - Intergenic
1084044692 11:66561849-66561871 CAGGAAGGACTGCTGGGGTGGGG + Intronic
1084118629 11:67056386-67056408 CAGGAAGCTCTGCTGCAGGTGGG - Intergenic
1084510507 11:69600730-69600752 CAGGAAGAACTGCTGGCAACGGG + Intergenic
1085523056 11:77149424-77149446 CATGAATAAATGCTGGAGGTAGG + Intronic
1086546908 11:88008070-88008092 CAGGAAGAATGACTGGCAGTGGG + Intergenic
1089066474 11:115665793-115665815 CAGGGAGCACTGCTGGGGGCTGG + Intergenic
1090117190 11:123985350-123985372 TTGGAAGAACTGCTGAGGGTGGG - Intergenic
1090306329 11:125694288-125694310 CTGGAAGATCTGATGGGGGTTGG + Intergenic
1091131266 11:133149016-133149038 GGGGAAGAACGGCTGGCAGTGGG - Intronic
1091465349 12:679027-679049 GAGGAAGAACTGCTGATGGAAGG - Intergenic
1091857908 12:3753755-3753777 CATGAAGAACAGCTGGTGTTTGG - Intronic
1094541826 12:31369207-31369229 CCGGAACAACGGCTGGGGGTGGG - Intergenic
1095606492 12:44073651-44073673 GAGGAAGTACTGTTGGAGGTTGG + Intronic
1099606675 12:84811393-84811415 GAGGAAGAAAAGCTGGCGGATGG - Intergenic
1099902148 12:88724272-88724294 GAGCAAGAGCTGCTGGAGGTAGG - Intergenic
1104915993 12:132264832-132264854 CAGGAACATCTGCTGACGGCTGG - Intronic
1106248577 13:27967881-27967903 CAGGGAGAGCTGCTGTCGCTGGG - Intronic
1108119255 13:47165329-47165351 CAAGAAAAACTGTTGGGGGTGGG + Intergenic
1108708615 13:53012050-53012072 CAGGTAGAACTTCTGGCTGGAGG + Intergenic
1115094580 14:29619456-29619478 CAGGAACAATTTCTGGCAGTGGG + Intronic
1115379151 14:32714103-32714125 CAGAGAGAACTGCTGGTGGGTGG + Intronic
1118796471 14:69150286-69150308 CAGGAAGTACTGATGGAGATGGG + Intronic
1118994430 14:70823092-70823114 CAGGAAGAGCTGCTGGCCCGAGG - Intergenic
1121976371 14:98407919-98407941 CAAGAAGAACTGATGGCTGGGGG + Intergenic
1122616237 14:103019914-103019936 CAAGAAGAACTGCAGGCGGAGGG + Intronic
1122857878 14:104568583-104568605 CAGGAAGAACTGAGGTCGTTTGG + Intronic
1124372682 15:29112286-29112308 CAGGGAGAACCGCTGCAGGTCGG - Intronic
1128680841 15:69650240-69650262 CTGGAGGATCTGCTGGAGGTTGG - Intergenic
1129326422 15:74802414-74802436 CATGAAGAACTGCTGGCACCTGG + Exonic
1131828554 15:96339813-96339835 CATGATGAAGTACTGGCGGTGGG - Exonic
1132953593 16:2578780-2578802 CAGGAAAAACTGTGGGAGGTGGG + Intronic
1132960758 16:2621387-2621409 CAGGAAAAACTGTGGGAGGTGGG - Intergenic
1133907811 16:10037942-10037964 CTGGAAGGACTGCTGGGTGTGGG - Intronic
1135424485 16:22325539-22325561 CCGGAAGAGCTGCTGGGGGGAGG + Intronic
1136628831 16:31477539-31477561 CAGGAAGCAGGGCTGGCAGTAGG - Exonic
1138137666 16:54537476-54537498 CAGGAAAAACTGCTGGGAGCAGG - Intergenic
1139486932 16:67263127-67263149 CAGCAGGAACTGCTGGAGGCAGG + Intronic
1139500496 16:67360304-67360326 CAGCAAGAAGTTCAGGCGGTAGG + Intronic
1142328594 16:89435000-89435022 CATGAAGAGCTGGTGGCTGTGGG - Intronic
1143255567 17:5555319-5555341 CAGGAAGAAAGGGTGGAGGTTGG - Intronic
1143471258 17:7177442-7177464 CATGAAGAAATGCGGGCGGTGGG + Intronic
1147137749 17:38443885-38443907 CAGGAAGCACTCCTGGGGGGCGG + Intronic
1147423202 17:40332588-40332610 CAGGAAGCAGTGGTGGTGGTGGG - Intronic
1149187478 17:54016580-54016602 CAGGGAGAACTGGTGGTGGGCGG + Intergenic
1150143658 17:62750560-62750582 CAGGAAGCAGCACTGGCGGTGGG + Intronic
1152479349 17:80539694-80539716 CAGGGAGAAATGCAGGGGGTGGG - Intergenic
1152986737 18:328222-328244 CAGAAATCACTGCTGGCGGCAGG + Intronic
1153366870 18:4266191-4266213 CAAGAAGAAGTGATGGAGGTTGG - Intronic
1158848880 18:61474079-61474101 CAGGAAGACCTGCCAGGGGTGGG - Intronic
1160618322 18:80150958-80150980 GAGGAAGAACTGGTGGGGCTTGG + Intronic
1160685483 19:434627-434649 CAGAAAGAAGAGCTGGAGGTAGG + Intronic
1161028181 19:2046247-2046269 CAGGAAGATGTGCTGGGGGAGGG - Exonic
1161058046 19:2200447-2200469 CAGGACAAACAGGTGGCGGTGGG - Intronic
1161104616 19:2437119-2437141 CAGGGAGAGCTGCTGGCTGCTGG - Intronic
1161168938 19:2803581-2803603 CAGGAGTGACGGCTGGCGGTCGG - Intronic
925232986 2:2252412-2252434 TAGGAAGAACAGCTTGTGGTGGG - Intronic
926162996 2:10501453-10501475 AAGGAACAGCTGCTGGCGGCTGG + Intergenic
929446002 2:42001921-42001943 CAGGCTGAACTGCTGGAGGAAGG - Intergenic
929779412 2:44948307-44948329 CAGGAAGACCTGTTAGAGGTGGG - Intergenic
932437822 2:71713158-71713180 CAGGAAGAACAAGTGGCGCTTGG + Intergenic
941962788 2:171270023-171270045 CAGGATGAAGTGCTGGGGGTGGG + Intergenic
944259324 2:197658700-197658722 GAGAAAGAACTGCTGGTGGTTGG - Intronic
946328496 2:218997036-218997058 CAGGAACAGCTGCTAGGGGTGGG - Intergenic
946397071 2:219448518-219448540 CAGGAAGAACTGCGGGCGCCAGG + Exonic
946428949 2:219614432-219614454 CAGGAAGATCAGCTAGCGGGTGG - Intronic
946650712 2:221890559-221890581 CAGGAGGAACTGCTGACCTTTGG + Intergenic
946880981 2:224176892-224176914 CAGGAAGAACTCGTGGTGGATGG - Intergenic
947638824 2:231694499-231694521 CAGAAGGAACTGGTGGAGGTGGG - Intergenic
1169065021 20:2690280-2690302 CAGGAAGAAGAGCTGGCTGGTGG + Intergenic
1169345270 20:4823756-4823778 CCGGAAGAATCGCTGGCGGCGGG - Intergenic
1171202867 20:23255940-23255962 CAGGGAGAGCTGCTGGGTGTGGG + Intergenic
1171374810 20:24685326-24685348 CAGGAAGCACTGGTAGCGGAAGG - Intergenic
1172061327 20:32189292-32189314 CAGGTAGTACTGCAGGGGGTTGG + Intergenic
1174531624 20:51219119-51219141 CAGAAATGACTGCTGGTGGTGGG + Intergenic
1175238894 20:57532028-57532050 CAGGAAAAACAGCTGGGAGTGGG + Intergenic
1175841828 20:62032930-62032952 CAAGAAGATCTGCTGGTGGCAGG - Intronic
1176052757 20:63129211-63129233 CACGAGGAGCTGCTGGCGGGGGG - Intergenic
1176120148 20:63450561-63450583 GGGGAAGACCTGCTGGGGGTGGG + Intronic
1179783682 21:43718388-43718410 CAGGAAGACCTGGTTGGGGTGGG + Intergenic
1179838752 21:44056329-44056351 CAGCAAGAACTGTTGGAGGCAGG + Intronic
1182125380 22:27811851-27811873 CAGGAAGAACCCCTGCTGGTTGG - Intergenic
1183331197 22:37222556-37222578 CAGGAAGACCTGCCGGTTGTGGG - Intergenic
1183765204 22:39866974-39866996 CAGGAGGCAGAGCTGGCGGTGGG - Intronic
949266379 3:2161402-2161424 CAGAGAGAACTGCTTGGGGTCGG + Intronic
952042948 3:29281847-29281869 CAGGAAGAAGTGATGGGGGTGGG - Intronic
954660493 3:52224417-52224439 CAGGAAGAACTTCTGCAGGTAGG - Intronic
955549253 3:60065981-60066003 CAAGAAGACCTCCTGGAGGTAGG - Intronic
961057983 3:123804951-123804973 CAGGAAGCACTGCTGACAGGAGG + Intronic
961738286 3:129015783-129015805 CAGGAAGAACAGCTTGGGGTAGG - Intronic
963140804 3:141944620-141944642 CAGTCAGAAGTGCTGGAGGTGGG - Intergenic
963623330 3:147639716-147639738 CAGGAAGAAGTGTGGGAGGTGGG + Intergenic
965486126 3:169280774-169280796 CAGAAAGAACTGATGCCAGTGGG + Intronic
965839180 3:172883633-172883655 CAGCAAGATGTGCTGGCTGTAGG + Intergenic
966871180 3:184291405-184291427 CACGAAGAAGAGCTGGTGGTTGG - Exonic
969110519 4:4841363-4841385 CAGGAAGATCAGCTGGGGATTGG - Intergenic
969172766 4:5377047-5377069 CAGGAAGCTCTGGTGGCTGTGGG - Intronic
969439894 4:7210844-7210866 CAGGAATGAATGCTGGGGGTTGG - Intronic
970231889 4:13919443-13919465 CTGGTAGAAGTGCTGGAGGTGGG - Intergenic
975754469 4:77559129-77559151 CAGAAGGTACTGCTGGTGGTAGG - Intronic
981214440 4:142147922-142147944 CAGGAAGAAATGCTGGGGAAGGG + Intronic
982313409 4:154008462-154008484 GAGAAAGAACTGCTGAGGGTGGG + Intergenic
984832991 4:183993062-183993084 CAGGAATCACCTCTGGCGGTGGG + Intronic
985564019 5:606345-606367 CAGGAAGGACTGGTGGGGCTGGG - Intergenic
987162151 5:15155616-15155638 CAGGAAGAATTCCTGGAGGAAGG + Intergenic
989552875 5:42756713-42756735 TGGTAAGAACTGCTGGTGGTAGG + Intergenic
990548012 5:56843188-56843210 CAGGAAGAACTGGTGGGTGGGGG - Intronic
992174737 5:74138915-74138937 CAGGCAGTACTTCTGGCAGTTGG + Intergenic
995743896 5:115383592-115383614 CAGGAAGAACTACTGCAGGAAGG + Intergenic
996323541 5:122246972-122246994 CACGAAGGCCTGTTGGCGGTTGG - Intergenic
997516030 5:134490597-134490619 CAGGAGGAATTGCTGGCTTTGGG - Intergenic
998014704 5:138722949-138722971 CTGCAAGGACTGCTGGGGGTGGG - Intronic
998026421 5:138820043-138820065 CAGGAAGCATGGCTGGCGGTGGG - Intronic
999584722 5:153077375-153077397 AAGAAAGAACTGTTGGGGGTTGG + Intergenic
1002708179 5:181177385-181177407 CAGAATGAACTGCTGGCATTTGG - Intergenic
1003209872 6:4052788-4052810 CAGGAACAACTGCTGACTATAGG - Exonic
1005243255 6:23854977-23854999 CAGGGAGCACTGCTGGAAGTGGG - Intergenic
1006600265 6:35220704-35220726 CAGGAAAAGCTGCTGGTGTTTGG - Intronic
1006640008 6:35485005-35485027 CAGGAAGCACTGCTGGGGGCTGG - Intronic
1015878420 6:137846959-137846981 CAGGAAGAGAGGCTGGCGGGAGG - Intergenic
1016563061 6:145418582-145418604 AAGGAAGAACTGGTAGCGGGTGG - Intergenic
1017143831 6:151216199-151216221 CTGGAAGACCTGCTGGGGGTGGG - Intergenic
1018424475 6:163667961-163667983 GAGGAAGGACTGCAGGGGGTGGG + Intergenic
1019382449 7:731068-731090 CAGCAAGAAGTGCAGGCGGCCGG + Intronic
1022500886 7:30881848-30881870 CAGGAGGAAAGGCTGGCAGTGGG + Intronic
1023791121 7:43754652-43754674 CAGGGAGAACTGCTGGAGAGAGG - Intergenic
1026880835 7:73905663-73905685 GGGGAAGAACAGCTGGCCGTGGG - Intergenic
1027319434 7:77002826-77002848 CAGGGAGAGCAGCTGGGGGTCGG - Intergenic
1028737587 7:94235096-94235118 CAGGAAGAACTGCCGTACGTTGG - Intergenic
1028937713 7:96484940-96484962 CAGGAATAACAGCTGACTGTAGG - Intronic
1029926296 7:104322368-104322390 CATGAAGAACTGCTGGAGTTTGG - Intergenic
1030247688 7:107402702-107402724 CAGGAAGAGCTGCAGGTGGATGG + Intronic
1032072796 7:128819217-128819239 GAGGAAGAACTGCTGGTGAAGGG + Intronic
1032700014 7:134371041-134371063 CAGGAAGAACGCATGGCGGAAGG - Intergenic
1034889533 7:154827709-154827731 CAGAAAGGACGGCTGGCGGGGGG + Intronic
1034963764 7:155378663-155378685 CAGGAGGAAGAGCTGGCCGTGGG - Intergenic
1035053214 7:156016216-156016238 CAAGAAGAACTGCTGGTGTGAGG - Intergenic
1036186383 8:6626042-6626064 CAGGAACAAAGGCTGGCGGGTGG - Intronic
1036795935 8:11756958-11756980 CTGGAAGCACCGCTGGCGGGAGG - Exonic
1039579833 8:38655801-38655823 TAGGAAGCACTGCTGAGGGTAGG - Intergenic
1040079293 8:43271329-43271351 CAGGAAGAACTCCTGTTGATGGG - Intergenic
1040600471 8:48878829-48878851 CAGGCAGCCCTGCTGGAGGTGGG - Intergenic
1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG + Exonic
1042207444 8:66343518-66343540 CAGGAAGAAATGCTGTTGGTTGG - Intergenic
1044729952 8:95221509-95221531 CAGAAAGCTCTGCTGGGGGTAGG - Intergenic
1045322483 8:101092392-101092414 CAGAATGAACGGCTGGCCGTGGG - Intergenic
1045714384 8:105024712-105024734 CAGGAAAAACTGTTGGAGATGGG + Intronic
1048564502 8:135581115-135581137 CAGGAAGAACTGCAGCTGGCAGG - Intronic
1049281786 8:141753184-141753206 AAGGAAGCACTCCTGGGGGTGGG - Intergenic
1049641911 8:143719652-143719674 CAGGAGGAGCTGCTGGGGGTGGG + Intronic
1050016499 9:1239482-1239504 CACCAAGAACTGCTTGAGGTGGG - Intergenic
1050038245 9:1460645-1460667 CAGGAAGAAAAGCAGGCGGGGGG + Intergenic
1051206360 9:14693266-14693288 GGGAAAGAGCTGCTGGCGGTCGG - Exonic
1051717273 9:19998343-19998365 CAGGAAGTACTGCTGCCAGAAGG - Intergenic
1052779640 9:32767387-32767409 CAGGAAGTATTGCTGGCCTTGGG - Intergenic
1052861182 9:33438930-33438952 CAGCCAGAACTGCTGGTGGAAGG + Intergenic
1057221623 9:93260612-93260634 CAGGAGGAACGGCTCACGGTGGG - Intronic
1059511093 9:114847954-114847976 CAGGAAAAACTGCTGACTATGGG - Intergenic
1061084303 9:128390287-128390309 GAGGAGCAGCTGCTGGCGGTGGG - Exonic
1203787051 EBV:133898-133920 CGGGAAGAGCTGCTGGAGCTGGG + Intergenic
1186113343 X:6278528-6278550 CACGAAGACCTGCTTGTGGTTGG - Intergenic
1187728383 X:22227577-22227599 CAGGAAGAAGAGCTGGTTGTTGG - Exonic
1190822839 X:53990420-53990442 CAAGAAGGACTGCTGGGGGTGGG + Intronic
1193645141 X:84058941-84058963 CAGGAAGTACTGTTGGTAGTTGG - Intronic
1193680332 X:84511108-84511130 CAGGAAGAAGGGCTGCAGGTAGG - Intergenic
1198790424 X:140339628-140339650 CAGGAAGAAATGCAGGAGCTAGG + Intergenic
1200000997 X:153059659-153059681 CAGGAACAACGGCTAGCGGTGGG - Intronic
1200236635 X:154470853-154470875 CAGGTAGAGATGCTGGTGGTCGG + Intronic
1201483607 Y:14468535-14468557 CATGAAGACCTGCTTGTGGTTGG + Intergenic