ID: 904813291

View in Genome Browser
Species Human (GRCh38)
Location 1:33178146-33178168
Sequence CAGGAGAGGGAGAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7108
Summary {0: 1, 1: 10, 2: 79, 3: 1042, 4: 5976}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904813291_904813303 22 Left 904813291 1:33178146-33178168 CCTTCCTCCCTCTCCCTCTCCTG 0: 1
1: 10
2: 79
3: 1042
4: 5976
Right 904813303 1:33178191-33178213 GTGGCACCAGATCATCTGCATGG 0: 1
1: 0
2: 0
3: 11
4: 132
904813291_904813298 -3 Left 904813291 1:33178146-33178168 CCTTCCTCCCTCTCCCTCTCCTG 0: 1
1: 10
2: 79
3: 1042
4: 5976
Right 904813298 1:33178166-33178188 CTGTTTCCCCATCTGTCAAGTGG 0: 1
1: 11
2: 162
3: 1226
4: 5191
904813291_904813300 3 Left 904813291 1:33178146-33178168 CCTTCCTCCCTCTCCCTCTCCTG 0: 1
1: 10
2: 79
3: 1042
4: 5976
Right 904813300 1:33178172-33178194 CCCCATCTGTCAAGTGGATGTGG 0: 1
1: 0
2: 1
3: 28
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904813291 Original CRISPR CAGGAGAGGGAGAGGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr